FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637383_at:

>probe:Drosophila_2:1637383_at:669:639; Interrogation_Position=2373; Antisense; TCGGCGGCGAGCGTTAGTGATTTCA
>probe:Drosophila_2:1637383_at:425:371; Interrogation_Position=2435; Antisense; GAAGGCAGCCAACCATCAGACACGA
>probe:Drosophila_2:1637383_at:694:63; Interrogation_Position=2464; Antisense; ATGTGGACATTGCTGTATCCTGCGT
>probe:Drosophila_2:1637383_at:7:485; Interrogation_Position=2478; Antisense; GTATCCTGCGTTGGCGTCAAGTTCA
>probe:Drosophila_2:1637383_at:596:183; Interrogation_Position=2515; Antisense; AAAAGACTGCCATCTGTTGCCATGA
>probe:Drosophila_2:1637383_at:600:29; Interrogation_Position=2550; Antisense; ATAAATTGTGTTTGCCAGGACTCGG
>probe:Drosophila_2:1637383_at:518:557; Interrogation_Position=2576; Antisense; GGACTTGCGCTACTTTGCGTACATA
>probe:Drosophila_2:1637383_at:669:615; Interrogation_Position=2617; Antisense; TGCACTACTGTCACGTCTTTATGGT
>probe:Drosophila_2:1637383_at:81:37; Interrogation_Position=2667; Antisense; ATCATCATGACGCTGGGACAGGCCT
>probe:Drosophila_2:1637383_at:118:375; Interrogation_Position=2694; Antisense; GAAGTTGCCTACCAGCTAGCTCTGA
>probe:Drosophila_2:1637383_at:88:81; Interrogation_Position=2725; Antisense; AGGGCACGTCCCTCAACGAAGAGTG
>probe:Drosophila_2:1637383_at:557:585; Interrogation_Position=2764; Antisense; TGGAAGTGCCACAATTGCCACCGAG
>probe:Drosophila_2:1637383_at:234:19; Interrogation_Position=2847; Antisense; ATTTGCTAGTCGTTGATGCCATCTC
>probe:Drosophila_2:1637383_at:282:447; Interrogation_Position=2872; Antisense; GATGCTGGCTTTGCTCCACATAAGG

Paste this into a BLAST search page for me
TCGGCGGCGAGCGTTAGTGATTTCAGAAGGCAGCCAACCATCAGACACGAATGTGGACATTGCTGTATCCTGCGTGTATCCTGCGTTGGCGTCAAGTTCAAAAAGACTGCCATCTGTTGCCATGAATAAATTGTGTTTGCCAGGACTCGGGGACTTGCGCTACTTTGCGTACATATGCACTACTGTCACGTCTTTATGGTATCATCATGACGCTGGGACAGGCCTGAAGTTGCCTACCAGCTAGCTCTGAAGGGCACGTCCCTCAACGAAGAGTGTGGAAGTGCCACAATTGCCACCGAGATTTGCTAGTCGTTGATGCCATCTCGATGCTGGCTTTGCTCCACATAAGG

Full Affymetrix probeset data:

Annotations for 1637383_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720