FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637388_at:

>probe:Drosophila_2:1637388_at:407:301; Interrogation_Position=113; Antisense; CCGTCTACACCCTGAACGGAGTGGG
>probe:Drosophila_2:1637388_at:208:153; Interrogation_Position=147; Antisense; ACATCCACTGGCTGTGGGCTGCAAG
>probe:Drosophila_2:1637388_at:440:351; Interrogation_Position=17; Antisense; GCAGCACATGGATGGGCAGAGCTCC
>probe:Drosophila_2:1637388_at:366:153; Interrogation_Position=248; Antisense; ACATGTGCGCTCTGACCTTGTATAT
>probe:Drosophila_2:1637388_at:173:611; Interrogation_Position=260; Antisense; TGACCTTGTATATCTGCTGCTGCTG
>probe:Drosophila_2:1637388_at:25:443; Interrogation_Position=27; Antisense; GATGGGCAGAGCTCCAGAACCGGCC
>probe:Drosophila_2:1637388_at:690:667; Interrogation_Position=304; Antisense; TACTTCATCAACTACTGCAAGAGTG
>probe:Drosophila_2:1637388_at:243:215; Interrogation_Position=322; Antisense; AAGAGTGTCCAGCACTACTGTCCCA
>probe:Drosophila_2:1637388_at:139:669; Interrogation_Position=337; Antisense; TACTGTCCCAACTGTGGATGCCACA
>probe:Drosophila_2:1637388_at:564:545; Interrogation_Position=352; Antisense; GGATGCCACATTGGGAGCTATAGCA
>probe:Drosophila_2:1637388_at:82:377; Interrogation_Position=43; Antisense; GAACCGGCCGACACGGAAATGGTGA
>probe:Drosophila_2:1637388_at:683:393; Interrogation_Position=58; Antisense; GAAATGGTGACCGTAACCACGCAGC
>probe:Drosophila_2:1637388_at:523:289; Interrogation_Position=69; Antisense; CGTAACCACGCAGCCAAACTATGGG
>probe:Drosophila_2:1637388_at:421:591; Interrogation_Position=95; Antisense; TGGTGGTGACCCAGATACCCGTCTA

Paste this into a BLAST search page for me
CCGTCTACACCCTGAACGGAGTGGGACATCCACTGGCTGTGGGCTGCAAGGCAGCACATGGATGGGCAGAGCTCCACATGTGCGCTCTGACCTTGTATATTGACCTTGTATATCTGCTGCTGCTGGATGGGCAGAGCTCCAGAACCGGCCTACTTCATCAACTACTGCAAGAGTGAAGAGTGTCCAGCACTACTGTCCCATACTGTCCCAACTGTGGATGCCACAGGATGCCACATTGGGAGCTATAGCAGAACCGGCCGACACGGAAATGGTGAGAAATGGTGACCGTAACCACGCAGCCGTAACCACGCAGCCAAACTATGGGTGGTGGTGACCCAGATACCCGTCTA

Full Affymetrix probeset data:

Annotations for 1637388_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720