Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637389_at:

>probe:Drosophila_2:1637389_at:434:363; Interrogation_Position=1255; Antisense; GAATTGGATGAGTCTGGCCAGCCAA
>probe:Drosophila_2:1637389_at:610:451; Interrogation_Position=1309; Antisense; GATCTCTTCTATGGTCACAACTCAG
>probe:Drosophila_2:1637389_at:181:159; Interrogation_Position=1325; Antisense; ACAACTCAGAGGTCTATCGTCGATT
>probe:Drosophila_2:1637389_at:654:449; Interrogation_Position=1436; Antisense; GATCCGCCAGTTTGCAGTTGAGTGA
>probe:Drosophila_2:1637389_at:652:219; Interrogation_Position=1484; Antisense; AAGTGCACAAAATCCCCGAGTGTCC
>probe:Drosophila_2:1637389_at:532:433; Interrogation_Position=1501; Antisense; GAGTGTCCCAAGAACTATCACATTG
>probe:Drosophila_2:1637389_at:279:329; Interrogation_Position=1539; Antisense; GCGTCCCTCGCCTTATTTAGAGGAG
>probe:Drosophila_2:1637389_at:312:81; Interrogation_Position=1562; Antisense; AGGTGAATCGGATCGTACTGCGCCT
>probe:Drosophila_2:1637389_at:177:229; Interrogation_Position=1640; Antisense; AATGGAGCATCCAACGGTTCCCCGA
>probe:Drosophila_2:1637389_at:50:631; Interrogation_Position=1658; Antisense; TCCCCGAATACTTGGCCGAACTAGA
>probe:Drosophila_2:1637389_at:678:519; Interrogation_Position=1692; Antisense; GTGGAAGGTGCTCACTTTGTCCGAC
>probe:Drosophila_2:1637389_at:17:709; Interrogation_Position=1731; Antisense; TTACGCCCTCACTATTGGATGTCTA
>probe:Drosophila_2:1637389_at:575:547; Interrogation_Position=1747; Antisense; GGATGTCTACTTTCAGCTATTGTTT
>probe:Drosophila_2:1637389_at:437:465; Interrogation_Position=1788; Antisense; GTTGGGCCGTCAACGAAGACTGCAT

Paste this into a BLAST search page for me
GAATTGGATGAGTCTGGCCAGCCAAGATCTCTTCTATGGTCACAACTCAGACAACTCAGAGGTCTATCGTCGATTGATCCGCCAGTTTGCAGTTGAGTGAAAGTGCACAAAATCCCCGAGTGTCCGAGTGTCCCAAGAACTATCACATTGGCGTCCCTCGCCTTATTTAGAGGAGAGGTGAATCGGATCGTACTGCGCCTAATGGAGCATCCAACGGTTCCCCGATCCCCGAATACTTGGCCGAACTAGAGTGGAAGGTGCTCACTTTGTCCGACTTACGCCCTCACTATTGGATGTCTAGGATGTCTACTTTCAGCTATTGTTTGTTGGGCCGTCAACGAAGACTGCAT

Full Affymetrix probeset data:

Annotations for 1637389_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime