Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637391_at:

>probe:Drosophila_2:1637391_at:7:123; Interrogation_Position=3178; Antisense; AGCGGTGGCTACTATGGTGCCATCT
>probe:Drosophila_2:1637391_at:672:627; Interrogation_Position=3195; Antisense; TGCCATCTCCTTGGGTCATGCGAAG
>probe:Drosophila_2:1637391_at:517:671; Interrogation_Position=3238; Antisense; TACCACGGTCTACTGTCCCATGGAT
>probe:Drosophila_2:1637391_at:107:309; Interrogation_Position=3255; Antisense; CCATGGATCGGGTCTGGCATCAGGC
>probe:Drosophila_2:1637391_at:621:19; Interrogation_Position=3296; Antisense; ATTTGGACTCCTCCCTGAGTGGATA
>probe:Drosophila_2:1637391_at:468:593; Interrogation_Position=3350; Antisense; TGGGAGCTGGATTCTACCGCTATGC
>probe:Drosophila_2:1637391_at:102:315; Interrogation_Position=3421; Antisense; GCCTACTTGAAGTCAGCACCCGTAA
>probe:Drosophila_2:1637391_at:668:489; Interrogation_Position=3442; Antisense; GTAACTCAACATGCCGTCCTGAAGG
>probe:Drosophila_2:1637391_at:636:635; Interrogation_Position=3518; Antisense; TCGAGTATGCCGTGAATGATCCCCA
>probe:Drosophila_2:1637391_at:441:467; Interrogation_Position=3610; Antisense; GTTGAGCCCGATGGCAATGTGCGCA
>probe:Drosophila_2:1637391_at:138:667; Interrogation_Position=3643; Antisense; TACTACGCCGACTGGGAGACGGGCT
>probe:Drosophila_2:1637391_at:310:135; Interrogation_Position=3671; Antisense; ACGCCGAGGTCATCAACAGTCGCGA
>probe:Drosophila_2:1637391_at:169:151; Interrogation_Position=3686; Antisense; ACAGTCGCGACCAGGGCAAAATTGT
>probe:Drosophila_2:1637391_at:47:245; Interrogation_Position=3705; Antisense; AATTGTGGCCAAGCGTCAGACGGAA

Paste this into a BLAST search page for me
AGCGGTGGCTACTATGGTGCCATCTTGCCATCTCCTTGGGTCATGCGAAGTACCACGGTCTACTGTCCCATGGATCCATGGATCGGGTCTGGCATCAGGCATTTGGACTCCTCCCTGAGTGGATATGGGAGCTGGATTCTACCGCTATGCGCCTACTTGAAGTCAGCACCCGTAAGTAACTCAACATGCCGTCCTGAAGGTCGAGTATGCCGTGAATGATCCCCAGTTGAGCCCGATGGCAATGTGCGCATACTACGCCGACTGGGAGACGGGCTACGCCGAGGTCATCAACAGTCGCGAACAGTCGCGACCAGGGCAAAATTGTAATTGTGGCCAAGCGTCAGACGGAA

Full Affymetrix probeset data:

Annotations for 1637391_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime