FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637392_at:

>probe:Drosophila_2:1637392_at:7:145; Interrogation_Position=145; Antisense; ACTGCGATCGTCATTAACTTGCTAA
>probe:Drosophila_2:1637392_at:249:313; Interrogation_Position=233; Antisense; GCCAGCGGCTCTTCGATATTTTGGG
>probe:Drosophila_2:1637392_at:41:569; Interrogation_Position=256; Antisense; GGCTTTCAAGCCGACGAATGTTTTG
>probe:Drosophila_2:1637392_at:414:25; Interrogation_Position=293; Antisense; ATAGTGATCCGGCTGCAACACACAG
>probe:Drosophila_2:1637392_at:150:35; Interrogation_Position=322; Antisense; ATCACCGTACGCACCAATTCAAAAT
>probe:Drosophila_2:1637392_at:277:63; Interrogation_Position=455; Antisense; ATGTGCTCAAGGACATCCACTCGAT
>probe:Drosophila_2:1637392_at:319:315; Interrogation_Position=503; Antisense; GCCGGCGCATTAGAGTTTGTCCTGT
>probe:Drosophila_2:1637392_at:183:139; Interrogation_Position=571; Antisense; ACGATATTCATCGATGCCGTTTCCA
>probe:Drosophila_2:1637392_at:714:625; Interrogation_Position=585; Antisense; TGCCGTTTCCATGCAGATTCCAAAT
>probe:Drosophila_2:1637392_at:700:463; Interrogation_Position=600; Antisense; GATTCCAAATGCACTAGGTCGACCA
>probe:Drosophila_2:1637392_at:98:579; Interrogation_Position=630; Antisense; GGCCGATCGTTTTTGCTATATGCTA
>probe:Drosophila_2:1637392_at:54:17; Interrogation_Position=659; Antisense; ATTTCGCTTCGGCACTATATTGTAG
>probe:Drosophila_2:1637392_at:317:21; Interrogation_Position=675; Antisense; ATATTGTAGTCTCGCCATCATGTGT
>probe:Drosophila_2:1637392_at:122:603; Interrogation_Position=697; Antisense; TGTTGTTGCACACCCAATATGTTGA

Paste this into a BLAST search page for me
ACTGCGATCGTCATTAACTTGCTAAGCCAGCGGCTCTTCGATATTTTGGGGGCTTTCAAGCCGACGAATGTTTTGATAGTGATCCGGCTGCAACACACAGATCACCGTACGCACCAATTCAAAATATGTGCTCAAGGACATCCACTCGATGCCGGCGCATTAGAGTTTGTCCTGTACGATATTCATCGATGCCGTTTCCATGCCGTTTCCATGCAGATTCCAAATGATTCCAAATGCACTAGGTCGACCAGGCCGATCGTTTTTGCTATATGCTAATTTCGCTTCGGCACTATATTGTAGATATTGTAGTCTCGCCATCATGTGTTGTTGTTGCACACCCAATATGTTGA

Full Affymetrix probeset data:

Annotations for 1637392_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720