Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637393_at:

>probe:Drosophila_2:1637393_at:56:123; Interrogation_Position=1315; Antisense; AGCGACGAGAAGAAGTCTTTGATCT
>probe:Drosophila_2:1637393_at:270:373; Interrogation_Position=1326; Antisense; GAAGTCTTTGATCTATGGACGCGAT
>probe:Drosophila_2:1637393_at:576:691; Interrogation_Position=1332; Antisense; TTTGATCTATGGACGCGATCGGGCT
>probe:Drosophila_2:1637393_at:506:37; Interrogation_Position=1336; Antisense; ATCTATGGACGCGATCGGGCTCAGG
>probe:Drosophila_2:1637393_at:38:279; Interrogation_Position=1338; Antisense; CTATGGACGCGATCGGGCTCAGGTA
>probe:Drosophila_2:1637393_at:209:129; Interrogation_Position=1344; Antisense; ACGCGATCGGGCTCAGGTACGTTAT
>probe:Drosophila_2:1637393_at:123:325; Interrogation_Position=1346; Antisense; GCGATCGGGCTCAGGTACGTTATGT
>probe:Drosophila_2:1637393_at:699:39; Interrogation_Position=1349; Antisense; ATCGGGCTCAGGTACGTTATGTAAC
>probe:Drosophila_2:1637393_at:662:571; Interrogation_Position=1353; Antisense; GGCTCAGGTACGTTATGTAACCTAT
>probe:Drosophila_2:1637393_at:118:267; Interrogation_Position=1357; Antisense; CAGGTACGTTATGTAACCTATCAAA
>probe:Drosophila_2:1637393_at:305:475; Interrogation_Position=1364; Antisense; GTTATGTAACCTATCAAAACTACGA
>probe:Drosophila_2:1637393_at:630:491; Interrogation_Position=1369; Antisense; GTAACCTATCAAAACTACGAGGAAG
>probe:Drosophila_2:1637393_at:668:435; Interrogation_Position=1387; Antisense; GAGGAAGACGAATAAGCAAACGATT
>probe:Drosophila_2:1637393_at:233:405; Interrogation_Position=1393; Antisense; GACGAATAAGCAAACGATTTAACTA

Paste this into a BLAST search page for me
AGCGACGAGAAGAAGTCTTTGATCTGAAGTCTTTGATCTATGGACGCGATTTTGATCTATGGACGCGATCGGGCTATCTATGGACGCGATCGGGCTCAGGCTATGGACGCGATCGGGCTCAGGTAACGCGATCGGGCTCAGGTACGTTATGCGATCGGGCTCAGGTACGTTATGTATCGGGCTCAGGTACGTTATGTAACGGCTCAGGTACGTTATGTAACCTATCAGGTACGTTATGTAACCTATCAAAGTTATGTAACCTATCAAAACTACGAGTAACCTATCAAAACTACGAGGAAGGAGGAAGACGAATAAGCAAACGATTGACGAATAAGCAAACGATTTAACTA

Full Affymetrix probeset data:

Annotations for 1637393_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime