Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637394_s_at:

>probe:Drosophila_2:1637394_s_at:138:467; Interrogation_Position=293; Antisense; GTTGGTTTCGCAGCATCTACGGCAT
>probe:Drosophila_2:1637394_s_at:342:35; Interrogation_Position=316; Antisense; ATCACGGCTGCCAATTGAGCGGAGT
>probe:Drosophila_2:1637394_s_at:49:655; Interrogation_Position=348; Antisense; TCAATTTGACGCGTAGCCAGCCAAG
>probe:Drosophila_2:1637394_s_at:350:189; Interrogation_Position=396; Antisense; AACAGGTGACGCAGGATGTGGCCAA
>probe:Drosophila_2:1637394_s_at:471:391; Interrogation_Position=484; Antisense; GAAACGCAGCACACTTTTTTGGCCA
>probe:Drosophila_2:1637394_s_at:631:535; Interrogation_Position=510; Antisense; GGTCCGCGTTTGATTAGCCAACTCA
>probe:Drosophila_2:1637394_s_at:171:35; Interrogation_Position=550; Antisense; ATCAGGGCAATTGACAGCTCTGCTC
>probe:Drosophila_2:1637394_s_at:296:633; Interrogation_Position=589; Antisense; TCCGCTTGGCACACAGTCACAGAGA
>probe:Drosophila_2:1637394_s_at:592:101; Interrogation_Position=609; Antisense; AGAGACACACATTGCCTTATGGCCA
>probe:Drosophila_2:1637394_s_at:684:585; Interrogation_Position=652; Antisense; TGGAGCCTGGGCAGTACGCAACACC
>probe:Drosophila_2:1637394_s_at:488:293; Interrogation_Position=701; Antisense; CGTTCGTCTCGATCATACAGCAAAT
>probe:Drosophila_2:1637394_s_at:469:395; Interrogation_Position=791; Antisense; GACAACCAGTTGCTCTGTGGTGCTA
>probe:Drosophila_2:1637394_s_at:576:515; Interrogation_Position=833; Antisense; GTGTGTGCCTTTGTGAACTGAACTG
>probe:Drosophila_2:1637394_s_at:560:383; Interrogation_Position=847; Antisense; GAACTGAACTGACCAACGTGCCAAG

Paste this into a BLAST search page for me
GTTGGTTTCGCAGCATCTACGGCATATCACGGCTGCCAATTGAGCGGAGTTCAATTTGACGCGTAGCCAGCCAAGAACAGGTGACGCAGGATGTGGCCAAGAAACGCAGCACACTTTTTTGGCCAGGTCCGCGTTTGATTAGCCAACTCAATCAGGGCAATTGACAGCTCTGCTCTCCGCTTGGCACACAGTCACAGAGAAGAGACACACATTGCCTTATGGCCATGGAGCCTGGGCAGTACGCAACACCCGTTCGTCTCGATCATACAGCAAATGACAACCAGTTGCTCTGTGGTGCTAGTGTGTGCCTTTGTGAACTGAACTGGAACTGAACTGACCAACGTGCCAAG

Full Affymetrix probeset data:

Annotations for 1637394_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime