FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637395_at:

>probe:Drosophila_2:1637395_at:666:517; Interrogation_Position=1041; Antisense; GTGGGAGTACGGATCCCCATACCAG
>probe:Drosophila_2:1637395_at:29:49; Interrogation_Position=1173; Antisense; ATCCTATGTTCCTTTGCCACATGAC
>probe:Drosophila_2:1637395_at:65:285; Interrogation_Position=1202; Antisense; CTGAATCCTACAAGCTTCCTGTGGA
>probe:Drosophila_2:1637395_at:333:593; Interrogation_Position=1221; Antisense; TGTGGATTACAGTCCCAAACCTAAC
>probe:Drosophila_2:1637395_at:219:129; Interrogation_Position=1268; Antisense; ACCACGAGCCACAGTCTTACAATGA
>probe:Drosophila_2:1637395_at:241:459; Interrogation_Position=1338; Antisense; GATTTGGTATGGAGACAGTTCCCTC
>probe:Drosophila_2:1637395_at:515:397; Interrogation_Position=788; Antisense; GACAACAGCCCTATCCGCAATATGG
>probe:Drosophila_2:1637395_at:533:241; Interrogation_Position=806; Antisense; AATATGGCCATCACGACGAGTCCTA
>probe:Drosophila_2:1637395_at:681:685; Interrogation_Position=829; Antisense; TATCTTCCCACCTACGGAGCTGAGG
>probe:Drosophila_2:1637395_at:593:607; Interrogation_Position=849; Antisense; TGAGGTCCCAGAGCCGCAGCATGCT
>probe:Drosophila_2:1637395_at:343:51; Interrogation_Position=869; Antisense; ATGCTCATCCTAAGCCCAAGCAAGT
>probe:Drosophila_2:1637395_at:690:75; Interrogation_Position=923; Antisense; AGGAGCCCAAGCACGGAGAGCACTC
>probe:Drosophila_2:1637395_at:505:585; Interrogation_Position=948; Antisense; TGGAAACCACAAAGCTACCGCCTAT
>probe:Drosophila_2:1637395_at:47:377; Interrogation_Position=993; Antisense; GAAGAACTATCAGAGCTCCAGCGCC

Paste this into a BLAST search page for me
GTGGGAGTACGGATCCCCATACCAGATCCTATGTTCCTTTGCCACATGACCTGAATCCTACAAGCTTCCTGTGGATGTGGATTACAGTCCCAAACCTAACACCACGAGCCACAGTCTTACAATGAGATTTGGTATGGAGACAGTTCCCTCGACAACAGCCCTATCCGCAATATGGAATATGGCCATCACGACGAGTCCTATATCTTCCCACCTACGGAGCTGAGGTGAGGTCCCAGAGCCGCAGCATGCTATGCTCATCCTAAGCCCAAGCAAGTAGGAGCCCAAGCACGGAGAGCACTCTGGAAACCACAAAGCTACCGCCTATGAAGAACTATCAGAGCTCCAGCGCC

Full Affymetrix probeset data:

Annotations for 1637395_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720