FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637399_at:

>probe:Drosophila_2:1637399_at:330:539; Interrogation_Position=111; Antisense; GGTATGAAACGCTTTGTATCCTCTT
>probe:Drosophila_2:1637399_at:342:601; Interrogation_Position=125; Antisense; TGTATCCTCTTTGATTCGCAAGTCC
>probe:Drosophila_2:1637399_at:611:647; Interrogation_Position=154; Antisense; TCAGTCCGTCGGAGCCTGGAAAATT
>probe:Drosophila_2:1637399_at:121:559; Interrogation_Position=171; Antisense; GGAAAATTGGCTGCCGGTTGCCCAG
>probe:Drosophila_2:1637399_at:394:215; Interrogation_Position=228; Antisense; AAGTTCAATGGTCAGTTCGCTCCGG
>probe:Drosophila_2:1637399_at:606:603; Interrogation_Position=271; Antisense; TGATCAAGCAAGAGTCCGGCCGCAA
>probe:Drosophila_2:1637399_at:229:699; Interrogation_Position=305; Antisense; TTTAACTTCCACAATTCGACTGCCA
>probe:Drosophila_2:1637399_at:229:177; Interrogation_Position=333; Antisense; AAACGTTCTTGGCTACAGAGGCGTG
>probe:Drosophila_2:1637399_at:274:99; Interrogation_Position=349; Antisense; AGAGGCGTGTGATTCCCGTTTAGAC
>probe:Drosophila_2:1637399_at:498:699; Interrogation_Position=367; Antisense; TTTAGACGTCGCTTGCGTGGTTAAA
>probe:Drosophila_2:1637399_at:461:493; Interrogation_Position=412; Antisense; GTAATCGCAACTTCAGTCGCAGTTT
>probe:Drosophila_2:1637399_at:585:501; Interrogation_Position=427; Antisense; GTCGCAGTTTTACAGTTTCACGCTC
>probe:Drosophila_2:1637399_at:288:155; Interrogation_Position=438; Antisense; ACAGTTTCACGCTCTGGTGTGCAAA
>probe:Drosophila_2:1637399_at:467:275; Interrogation_Position=487; Antisense; CTTGATTTTCTATGATTTGCCGGGA

Paste this into a BLAST search page for me
GGTATGAAACGCTTTGTATCCTCTTTGTATCCTCTTTGATTCGCAAGTCCTCAGTCCGTCGGAGCCTGGAAAATTGGAAAATTGGCTGCCGGTTGCCCAGAAGTTCAATGGTCAGTTCGCTCCGGTGATCAAGCAAGAGTCCGGCCGCAATTTAACTTCCACAATTCGACTGCCAAAACGTTCTTGGCTACAGAGGCGTGAGAGGCGTGTGATTCCCGTTTAGACTTTAGACGTCGCTTGCGTGGTTAAAGTAATCGCAACTTCAGTCGCAGTTTGTCGCAGTTTTACAGTTTCACGCTCACAGTTTCACGCTCTGGTGTGCAAACTTGATTTTCTATGATTTGCCGGGA

Full Affymetrix probeset data:

Annotations for 1637399_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720