FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637401_at:

>probe:Drosophila_2:1637401_at:623:317; Interrogation_Position=1005; Antisense; GCTCGAACCGAACAATTGGCCAATT
>probe:Drosophila_2:1637401_at:34:581; Interrogation_Position=1021; Antisense; TGGCCAATTCTGATGGTGTTCTTTG
>probe:Drosophila_2:1637401_at:656:513; Interrogation_Position=1036; Antisense; GTGTTCTTTGTTTTAGTGTACGCGT
>probe:Drosophila_2:1637401_at:719:435; Interrogation_Position=558; Antisense; GAGGACCTCGTCGATTGTGCCAGTG
>probe:Drosophila_2:1637401_at:571:303; Interrogation_Position=611; Antisense; CCGAGCTGCGTCTCAACTGGGAGGA
>probe:Drosophila_2:1637401_at:513:679; Interrogation_Position=651; Antisense; TAGTGTGCCGCTCACTTCGCTAATG
>probe:Drosophila_2:1637401_at:180:567; Interrogation_Position=692; Antisense; GGCACACACAGTTTCGTAGCGGCTA
>probe:Drosophila_2:1637401_at:391:571; Interrogation_Position=712; Antisense; GGCTACAGCGGTCCAGTATTTGTTG
>probe:Drosophila_2:1637401_at:694:465; Interrogation_Position=733; Antisense; GTTGTAGACCATTATCGCATCTGGG
>probe:Drosophila_2:1637401_at:42:625; Interrogation_Position=815; Antisense; TGCCCGATTGCCTCAAGACGAACAT
>probe:Drosophila_2:1637401_at:329:385; Interrogation_Position=834; Antisense; GAACATCAAGTTCATTCGGCCCTTT
>probe:Drosophila_2:1637401_at:668:491; Interrogation_Position=949; Antisense; GTAATCCTACTCAGGCTAGCAACAA
>probe:Drosophila_2:1637401_at:55:239; Interrogation_Position=972; Antisense; AATCTGGTACTGTGATTGGGCCAAA
>probe:Drosophila_2:1637401_at:290:729; Interrogation_Position=987; Antisense; TTGGGCCAAATGTGCTTCGCTCGAA

Paste this into a BLAST search page for me
GCTCGAACCGAACAATTGGCCAATTTGGCCAATTCTGATGGTGTTCTTTGGTGTTCTTTGTTTTAGTGTACGCGTGAGGACCTCGTCGATTGTGCCAGTGCCGAGCTGCGTCTCAACTGGGAGGATAGTGTGCCGCTCACTTCGCTAATGGGCACACACAGTTTCGTAGCGGCTAGGCTACAGCGGTCCAGTATTTGTTGGTTGTAGACCATTATCGCATCTGGGTGCCCGATTGCCTCAAGACGAACATGAACATCAAGTTCATTCGGCCCTTTGTAATCCTACTCAGGCTAGCAACAAAATCTGGTACTGTGATTGGGCCAAATTGGGCCAAATGTGCTTCGCTCGAA

Full Affymetrix probeset data:

Annotations for 1637401_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720