FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637402_at:

>probe:Drosophila_2:1637402_at:13:291; Interrogation_Position=174; Antisense; CGGAGTGCTCACTTAATTGTTATAA
>probe:Drosophila_2:1637402_at:22:163; Interrogation_Position=279; Antisense; AAATTCTTCAAGCAACCGAGGCGTT
>probe:Drosophila_2:1637402_at:381:43; Interrogation_Position=293; Antisense; ACCGAGGCGTTGATTATTTACTTTG
>probe:Drosophila_2:1637402_at:94:149; Interrogation_Position=312; Antisense; ACTTTGATTCACAAGACACCTCCTT
>probe:Drosophila_2:1637402_at:566:105; Interrogation_Position=325; Antisense; AGACACCTCCTTTATCGACACTATT
>probe:Drosophila_2:1637402_at:161:399; Interrogation_Position=341; Antisense; GACACTATTCCCAAGACGTTAGCGA
>probe:Drosophila_2:1637402_at:242:155; Interrogation_Position=373; Antisense; ACAGATTCAGCTGGGCTTTCTGCTA
>probe:Drosophila_2:1637402_at:463:339; Interrogation_Position=394; Antisense; GCTAACCTCTTCCACTTCAGAAGAA
>probe:Drosophila_2:1637402_at:681:175; Interrogation_Position=450; Antisense; AAACGAATTTCCTTTTTGACATCAT
>probe:Drosophila_2:1637402_at:615:59; Interrogation_Position=567; Antisense; ATGTCAAGTTTGGTTCTGATCACAA
>probe:Drosophila_2:1637402_at:616:647; Interrogation_Position=600; Antisense; TCAGTGCCGACGAGCTGGATAGTCA
>probe:Drosophila_2:1637402_at:426:691; Interrogation_Position=635; Antisense; TTTGAAAACTTACTCCTCACGGCGC
>probe:Drosophila_2:1637402_at:316:185; Interrogation_Position=693; Antisense; AACAATTTCTGGATCGGGCTGAGCA
>probe:Drosophila_2:1637402_at:166:481; Interrogation_Position=718; Antisense; GTTTGCAGGCATAGTTTCCTCGATT

Paste this into a BLAST search page for me
CGGAGTGCTCACTTAATTGTTATAAAAATTCTTCAAGCAACCGAGGCGTTACCGAGGCGTTGATTATTTACTTTGACTTTGATTCACAAGACACCTCCTTAGACACCTCCTTTATCGACACTATTGACACTATTCCCAAGACGTTAGCGAACAGATTCAGCTGGGCTTTCTGCTAGCTAACCTCTTCCACTTCAGAAGAAAAACGAATTTCCTTTTTGACATCATATGTCAAGTTTGGTTCTGATCACAATCAGTGCCGACGAGCTGGATAGTCATTTGAAAACTTACTCCTCACGGCGCAACAATTTCTGGATCGGGCTGAGCAGTTTGCAGGCATAGTTTCCTCGATT

Full Affymetrix probeset data:

Annotations for 1637402_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720