FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637403_at:

>probe:Drosophila_2:1637403_at:687:307; Interrogation_Position=499; Antisense; CCAGTTGGGTCTGTCCGTGGAGTAC
>probe:Drosophila_2:1637403_at:424:449; Interrogation_Position=528; Antisense; GATCCGGAGAGCTGTTGTTCGATTT
>probe:Drosophila_2:1637403_at:721:19; Interrogation_Position=549; Antisense; ATTTGGTCAACCTGCGTATTGCTGG
>probe:Drosophila_2:1637403_at:714:217; Interrogation_Position=581; Antisense; AAGTACAAGCTTCCCATGCTGTGGG
>probe:Drosophila_2:1637403_at:727:613; Interrogation_Position=627; Antisense; TGAAGACCACCATCTCGTTGGAGTC
>probe:Drosophila_2:1637403_at:697:549; Interrogation_Position=646; Antisense; GGAGTCTGTGACTTCGGACATCACT
>probe:Drosophila_2:1637403_at:272:35; Interrogation_Position=665; Antisense; ATCACTGGATTCATGGGCAACGGCA
>probe:Drosophila_2:1637403_at:349:75; Interrogation_Position=753; Antisense; AGGACGCCATTTCCGAGACCATTGA
>probe:Drosophila_2:1637403_at:11:425; Interrogation_Position=767; Antisense; GAGACCATTGAGAACGCCATCGTGC
>probe:Drosophila_2:1637403_at:476:637; Interrogation_Position=786; Antisense; TCGTGCCGCGAGTGAACAAGATGCT
>probe:Drosophila_2:1637403_at:375:81; Interrogation_Position=813; Antisense; AGGGCAAGGACTTCTGGACCGTCGT
>probe:Drosophila_2:1637403_at:369:417; Interrogation_Position=868; Antisense; GAGCGAGGACGATCCGATTGTCGTT
>probe:Drosophila_2:1637403_at:466:465; Interrogation_Position=883; Antisense; GATTGTCGTTGATTGCGATCCCTCC
>probe:Drosophila_2:1637403_at:202:521; Interrogation_Position=997; Antisense; GTGGAATCCCATTGGACTCTCATTT

Paste this into a BLAST search page for me
CCAGTTGGGTCTGTCCGTGGAGTACGATCCGGAGAGCTGTTGTTCGATTTATTTGGTCAACCTGCGTATTGCTGGAAGTACAAGCTTCCCATGCTGTGGGTGAAGACCACCATCTCGTTGGAGTCGGAGTCTGTGACTTCGGACATCACTATCACTGGATTCATGGGCAACGGCAAGGACGCCATTTCCGAGACCATTGAGAGACCATTGAGAACGCCATCGTGCTCGTGCCGCGAGTGAACAAGATGCTAGGGCAAGGACTTCTGGACCGTCGTGAGCGAGGACGATCCGATTGTCGTTGATTGTCGTTGATTGCGATCCCTCCGTGGAATCCCATTGGACTCTCATTT

Full Affymetrix probeset data:

Annotations for 1637403_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720