FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637404_at:

>probe:Drosophila_2:1637404_at:45:613; Interrogation_Position=183; Antisense; TGAAAAGTTTCACTGCGATCGCAAT
>probe:Drosophila_2:1637404_at:575:43; Interrogation_Position=200; Antisense; ATCGCAATGTCTCGCTGGGCTTGGA
>probe:Drosophila_2:1637404_at:629:51; Interrogation_Position=269; Antisense; ATGCGGTCACCATTAAGGCCGTTGA
>probe:Drosophila_2:1637404_at:174:95; Interrogation_Position=305; Antisense; AGATTACGCTCAGCTTCGAGTCGGA
>probe:Drosophila_2:1637404_at:707:355; Interrogation_Position=341; Antisense; GCACGGCGGACTACGAGCTGAAGCT
>probe:Drosophila_2:1637404_at:449:179; Interrogation_Position=400; Antisense; AAAAAGGACTACACCTGCTTCATCC
>probe:Drosophila_2:1637404_at:325:49; Interrogation_Position=421; Antisense; ATCCAGTTGCCGTCGTCAGAGTTCG
>probe:Drosophila_2:1637404_at:379:429; Interrogation_Position=439; Antisense; GAGTTCGCGCGCATTTGCCGGGACA
>probe:Drosophila_2:1637404_at:380:57; Interrogation_Position=463; Antisense; ATGAGCATGTTCGACGAGTCCCTGA
>probe:Drosophila_2:1637404_at:277:373; Interrogation_Position=504; Antisense; GAAGGGCATCAGGTTCTTGGCCAAG
>probe:Drosophila_2:1637404_at:309:191; Interrogation_Position=547; Antisense; AACATTCAGCTGAGTGCGGGCACCG
>probe:Drosophila_2:1637404_at:223:355; Interrogation_Position=566; Antisense; GCACCGCCATGGACGTGAGCATTGA
>probe:Drosophila_2:1637404_at:692:433; Interrogation_Position=721; Antisense; GAGGATTACGGCCACATTCGATACT
>probe:Drosophila_2:1637404_at:567:221; Interrogation_Position=756; Antisense; CAAGGTGAATGACCCCGATTTCTAG

Paste this into a BLAST search page for me
TGAAAAGTTTCACTGCGATCGCAATATCGCAATGTCTCGCTGGGCTTGGAATGCGGTCACCATTAAGGCCGTTGAAGATTACGCTCAGCTTCGAGTCGGAGCACGGCGGACTACGAGCTGAAGCTAAAAAGGACTACACCTGCTTCATCCATCCAGTTGCCGTCGTCAGAGTTCGGAGTTCGCGCGCATTTGCCGGGACAATGAGCATGTTCGACGAGTCCCTGAGAAGGGCATCAGGTTCTTGGCCAAGAACATTCAGCTGAGTGCGGGCACCGGCACCGCCATGGACGTGAGCATTGAGAGGATTACGGCCACATTCGATACTCAAGGTGAATGACCCCGATTTCTAG

Full Affymetrix probeset data:

Annotations for 1637404_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720