Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637405_at:

>probe:Drosophila_2:1637405_at:305:729; Interrogation_Position=1657; Antisense; TTGGTCCAACTTTCTGTACGATGCG
>probe:Drosophila_2:1637405_at:539:287; Interrogation_Position=1691; Antisense; CGGCTAATGCTGATCGACTTCGGTT
>probe:Drosophila_2:1637405_at:321:471; Interrogation_Position=1713; Antisense; GTTCGACGCGCTTCTATAGGCATGA
>probe:Drosophila_2:1637405_at:99:569; Interrogation_Position=1731; Antisense; GGCATGAATTCATCCGCAACTATCG
>probe:Drosophila_2:1637405_at:327:319; Interrogation_Position=1775; Antisense; GCCGAGAACAATCGTCAGGGCGTTT
>probe:Drosophila_2:1637405_at:303:443; Interrogation_Position=1804; Antisense; GATGTCGCGCGAAATGGGCTTCCTA
>probe:Drosophila_2:1637405_at:490:63; Interrogation_Position=1817; Antisense; ATGGGCTTCCTAACCGGCTACGAGA
>probe:Drosophila_2:1637405_at:474:641; Interrogation_Position=1893; Antisense; TCTTTCGCTACGACGGTGATTTCGA
>probe:Drosophila_2:1637405_at:516:229; Interrogation_Position=1966; Antisense; AATGGTGGCGCATCGATTGTGCCCG
>probe:Drosophila_2:1637405_at:291:551; Interrogation_Position=1999; Antisense; GGAGATATACTCCATTCATCGCAAG
>probe:Drosophila_2:1637405_at:690:711; Interrogation_Position=2013; Antisense; TTCATCGCAAGCTATCGGGCATTTT
>probe:Drosophila_2:1637405_at:614:347; Interrogation_Position=2064; Antisense; GCATGAATTGCGTGCCCTTCTACAA
>probe:Drosophila_2:1637405_at:674:305; Interrogation_Position=2079; Antisense; CCTTCTACAAGGACATCGTTCTGGG
>probe:Drosophila_2:1637405_at:276:727; Interrogation_Position=2169; Antisense; TTGTCCAATCCAATCCCAGTTGTAA

Paste this into a BLAST search page for me
TTGGTCCAACTTTCTGTACGATGCGCGGCTAATGCTGATCGACTTCGGTTGTTCGACGCGCTTCTATAGGCATGAGGCATGAATTCATCCGCAACTATCGGCCGAGAACAATCGTCAGGGCGTTTGATGTCGCGCGAAATGGGCTTCCTAATGGGCTTCCTAACCGGCTACGAGATCTTTCGCTACGACGGTGATTTCGAAATGGTGGCGCATCGATTGTGCCCGGGAGATATACTCCATTCATCGCAAGTTCATCGCAAGCTATCGGGCATTTTGCATGAATTGCGTGCCCTTCTACAACCTTCTACAAGGACATCGTTCTGGGTTGTCCAATCCAATCCCAGTTGTAA

Full Affymetrix probeset data:

Annotations for 1637405_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime