FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637407_at:

>probe:Drosophila_2:1637407_at:504:241; Interrogation_Position=1085; Antisense; AATACTCCAAGTGATCTTCCAGAAA
>probe:Drosophila_2:1637407_at:41:131; Interrogation_Position=1152; Antisense; ACCTGCGAGAATACGGAACCCAACT
>probe:Drosophila_2:1637407_at:272:117; Interrogation_Position=1193; Antisense; AGCTCAGAGAGCTTCGACATTTTGA
>probe:Drosophila_2:1637407_at:516:419; Interrogation_Position=1232; Antisense; GAGCATTTGGAAGTCGACACTTTTA
>probe:Drosophila_2:1637407_at:607:657; Interrogation_Position=1255; Antisense; TAAGCTTATAATGGCGCTAACGCAA
>probe:Drosophila_2:1637407_at:689:701; Interrogation_Position=1330; Antisense; TTTTCCCACGGAATCCATTCTATAT
>probe:Drosophila_2:1637407_at:290:491; Interrogation_Position=1374; Antisense; GTAAGCACCATCCAAAGTGGGACTT
>probe:Drosophila_2:1637407_at:452:11; Interrogation_Position=1416; Antisense; ATTCGTCGGATATTTTGAGGCGCGT
>probe:Drosophila_2:1637407_at:434:439; Interrogation_Position=1432; Antisense; GAGGCGCGTACGAATGTTTTTTGTT
>probe:Drosophila_2:1637407_at:241:725; Interrogation_Position=1452; Antisense; TTGTTTCTACTGGACCGAATCCCTA
>probe:Drosophila_2:1637407_at:444:405; Interrogation_Position=1464; Antisense; GACCGAATCCCTATGCTGAATTTTT
>probe:Drosophila_2:1637407_at:63:373; Interrogation_Position=1499; Antisense; GAAGTATGTCCTGGATACTACGACA
>probe:Drosophila_2:1637407_at:70:675; Interrogation_Position=1556; Antisense; TACCTTACCTTATGTGAATTCCACT
>probe:Drosophila_2:1637407_at:443:9; Interrogation_Position=1573; Antisense; ATTCCACTGCCTTACGATCATATAA

Paste this into a BLAST search page for me
AATACTCCAAGTGATCTTCCAGAAAACCTGCGAGAATACGGAACCCAACTAGCTCAGAGAGCTTCGACATTTTGAGAGCATTTGGAAGTCGACACTTTTATAAGCTTATAATGGCGCTAACGCAATTTTCCCACGGAATCCATTCTATATGTAAGCACCATCCAAAGTGGGACTTATTCGTCGGATATTTTGAGGCGCGTGAGGCGCGTACGAATGTTTTTTGTTTTGTTTCTACTGGACCGAATCCCTAGACCGAATCCCTATGCTGAATTTTTGAAGTATGTCCTGGATACTACGACATACCTTACCTTATGTGAATTCCACTATTCCACTGCCTTACGATCATATAA

Full Affymetrix probeset data:

Annotations for 1637407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720