Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637408_at:

>probe:Drosophila_2:1637408_at:395:133; Interrogation_Position=110; Antisense; ACGTTATCCGGAGAATACCTCGCTC
>probe:Drosophila_2:1637408_at:571:51; Interrogation_Position=13; Antisense; ATGCTGTTCCTCTGTTTGATGATGA
>probe:Drosophila_2:1637408_at:582:443; Interrogation_Position=136; Antisense; GATGAACCCGGTCCGGATGCCAAAG
>probe:Drosophila_2:1637408_at:147:527; Interrogation_Position=161; Antisense; GGGACCTGAAGCTGTTGCATGCTCC
>probe:Drosophila_2:1637408_at:558:337; Interrogation_Position=181; Antisense; GCTCCCTGCGAGTTTGACTTGATAA
>probe:Drosophila_2:1637408_at:601:13; Interrogation_Position=217; Antisense; ATTAACCACTATCCCATTTATTGCC
>probe:Drosophila_2:1637408_at:407:303; Interrogation_Position=245; Antisense; CCGTCTACACAAATCGGCACGTGAA
>probe:Drosophila_2:1637408_at:193:405; Interrogation_Position=274; Antisense; GACTGGTATCGACTTTATAGGACCT
>probe:Drosophila_2:1637408_at:600:641; Interrogation_Position=291; Antisense; TAGGACCTACGACACCGAGGGATTT
>probe:Drosophila_2:1637408_at:286:687; Interrogation_Position=318; Antisense; TTTCGGGCAGTTTTACGAGCGTCTC
>probe:Drosophila_2:1637408_at:383:137; Interrogation_Position=332; Antisense; ACGAGCGTCTCCAGCGGTACGAGTT
>probe:Drosophila_2:1637408_at:393:577; Interrogation_Position=59; Antisense; GGCCCACGCCGAAAAATCTGCTGGA
>probe:Drosophila_2:1637408_at:252:333; Interrogation_Position=78; Antisense; GCTGGAACAAATGCTGCCTGCTGAC
>probe:Drosophila_2:1637408_at:355:329; Interrogation_Position=97; Antisense; GCTGACACCTTTGACGTTATCCGGA

Paste this into a BLAST search page for me
ACGTTATCCGGAGAATACCTCGCTCATGCTGTTCCTCTGTTTGATGATGAGATGAACCCGGTCCGGATGCCAAAGGGGACCTGAAGCTGTTGCATGCTCCGCTCCCTGCGAGTTTGACTTGATAAATTAACCACTATCCCATTTATTGCCCCGTCTACACAAATCGGCACGTGAAGACTGGTATCGACTTTATAGGACCTTAGGACCTACGACACCGAGGGATTTTTTCGGGCAGTTTTACGAGCGTCTCACGAGCGTCTCCAGCGGTACGAGTTGGCCCACGCCGAAAAATCTGCTGGAGCTGGAACAAATGCTGCCTGCTGACGCTGACACCTTTGACGTTATCCGGA

Full Affymetrix probeset data:

Annotations for 1637408_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime