FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637413_at:

>probe:Drosophila_2:1637413_at:289:149; Interrogation_Position=1505; Antisense; ACATTGTGTGGGTCGGGTACTGTTT
>probe:Drosophila_2:1637413_at:428:489; Interrogation_Position=1521; Antisense; GTACTGTTTACTGACTGGCTCTCAA
>probe:Drosophila_2:1637413_at:399:255; Interrogation_Position=1581; Antisense; CAAATATTACACGTCCGTTGCCGTT
>probe:Drosophila_2:1637413_at:62:505; Interrogation_Position=1593; Antisense; GTCCGTTGCCGTTAGAACTCTAGTT
>probe:Drosophila_2:1637413_at:53:341; Interrogation_Position=1632; Antisense; GCTACAAATTACACGCTGCATACTA
>probe:Drosophila_2:1637413_at:115:123; Interrogation_Position=1738; Antisense; AGCGAACGACACTGACTTATTTACA
>probe:Drosophila_2:1637413_at:15:247; Interrogation_Position=1762; Antisense; AATTCATTGCGTTGCTTGTGTGGCT
>probe:Drosophila_2:1637413_at:1:721; Interrogation_Position=1816; Antisense; TTGCCACACACAGTTCGGTTCGGTT
>probe:Drosophila_2:1637413_at:610:705; Interrogation_Position=1829; Antisense; TTCGGTTCGGTTGACTACTATACAT
>probe:Drosophila_2:1637413_at:328:693; Interrogation_Position=1877; Antisense; TTTGTTACGCCAACAGTAGGTCCGT
>probe:Drosophila_2:1637413_at:30:411; Interrogation_Position=1921; Antisense; GACGAATTGCGTTTTCTATCAGAAA
>probe:Drosophila_2:1637413_at:540:163; Interrogation_Position=1943; Antisense; AAATCAGGGCTAGTACTCCAAGTAC
>probe:Drosophila_2:1637413_at:162:673; Interrogation_Position=1975; Antisense; TACGCGATGGCTGCGAACAGCGTCT
>probe:Drosophila_2:1637413_at:679:261; Interrogation_Position=1992; Antisense; CAGCGTCTACTGTTCGAGGAGATTC

Paste this into a BLAST search page for me
ACATTGTGTGGGTCGGGTACTGTTTGTACTGTTTACTGACTGGCTCTCAACAAATATTACACGTCCGTTGCCGTTGTCCGTTGCCGTTAGAACTCTAGTTGCTACAAATTACACGCTGCATACTAAGCGAACGACACTGACTTATTTACAAATTCATTGCGTTGCTTGTGTGGCTTTGCCACACACAGTTCGGTTCGGTTTTCGGTTCGGTTGACTACTATACATTTTGTTACGCCAACAGTAGGTCCGTGACGAATTGCGTTTTCTATCAGAAAAAATCAGGGCTAGTACTCCAAGTACTACGCGATGGCTGCGAACAGCGTCTCAGCGTCTACTGTTCGAGGAGATTC

Full Affymetrix probeset data:

Annotations for 1637413_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720