FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637415_at:

>probe:Drosophila_2:1637415_at:188:51; Interrogation_Position=241; Antisense; ATGCCCACGTTTGCTGATCTTTTTG
>probe:Drosophila_2:1637415_at:370:591; Interrogation_Position=264; Antisense; TGGTCAGCCCTCTTATGAATCAGTG
>probe:Drosophila_2:1637415_at:195:239; Interrogation_Position=281; Antisense; AATCAGTGTTGCAGGAGCCCGAGGT
>probe:Drosophila_2:1637415_at:413:245; Interrogation_Position=368; Antisense; AATTCACTAATATTCCGGCCACGAT
>probe:Drosophila_2:1637415_at:69:245; Interrogation_Position=404; Antisense; AATTTGGGATCATTGGGCTGCTGGC
>probe:Drosophila_2:1637415_at:673:351; Interrogation_Position=465; Antisense; GCAGCTGGTCTTTGGTGAGGATCTA
>probe:Drosophila_2:1637415_at:24:437; Interrogation_Position=481; Antisense; GAGGATCTAACCACCTACGGACTAG
>probe:Drosophila_2:1637415_at:335:335; Interrogation_Position=511; Antisense; GCTGCCCAGGGAGACATTTATGTGC
>probe:Drosophila_2:1637415_at:182:63; Interrogation_Position=530; Antisense; ATGTGCATTTCAATGGGCCTCTAAC
>probe:Drosophila_2:1637415_at:58:107; Interrogation_Position=571; Antisense; AGAAATTCCATGGACTGCGCCCTTG
>probe:Drosophila_2:1637415_at:484:233; Interrogation_Position=603; Antisense; AATGCGTGCCATGCGTGATTCGATT
>probe:Drosophila_2:1637415_at:251:371; Interrogation_Position=642; Antisense; GAAGGCTCCGTGTTGGGATCCATTT
>probe:Drosophila_2:1637415_at:502:545; Interrogation_Position=657; Antisense; GGATCCATTTGAGCCAGAGACCCAA
>probe:Drosophila_2:1637415_at:312:149; Interrogation_Position=690; Antisense; ACTTGTGGGCAGTCTTGAACCGGAT

Paste this into a BLAST search page for me
ATGCCCACGTTTGCTGATCTTTTTGTGGTCAGCCCTCTTATGAATCAGTGAATCAGTGTTGCAGGAGCCCGAGGTAATTCACTAATATTCCGGCCACGATAATTTGGGATCATTGGGCTGCTGGCGCAGCTGGTCTTTGGTGAGGATCTAGAGGATCTAACCACCTACGGACTAGGCTGCCCAGGGAGACATTTATGTGCATGTGCATTTCAATGGGCCTCTAACAGAAATTCCATGGACTGCGCCCTTGAATGCGTGCCATGCGTGATTCGATTGAAGGCTCCGTGTTGGGATCCATTTGGATCCATTTGAGCCAGAGACCCAAACTTGTGGGCAGTCTTGAACCGGAT

Full Affymetrix probeset data:

Annotations for 1637415_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720