Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637417_at:

>probe:Drosophila_2:1637417_at:189:569; Interrogation_Position=1376; Antisense; GGCATACCCATACCGCAGAATATTA
>probe:Drosophila_2:1637417_at:266:277; Interrogation_Position=1398; Antisense; TTAAGTCCTGGGTTACTCAGAAACA
>probe:Drosophila_2:1637417_at:350:469; Interrogation_Position=1432; Antisense; GTTCCTCACCAAGATGTACGTGGCC
>probe:Drosophila_2:1637417_at:468:283; Interrogation_Position=1471; Antisense; CTGCTCACGGGCCATCAAGATGAAG
>probe:Drosophila_2:1637417_at:53:225; Interrogation_Position=1493; Antisense; AAGGACATGTTTCACGGATTCGCGC
>probe:Drosophila_2:1637417_at:613:259; Interrogation_Position=1505; Antisense; CACGGATTCGCGCTTATCAATGACG
>probe:Drosophila_2:1637417_at:678:139; Interrogation_Position=1535; Antisense; ACGGCTAATGAGCAACGCGGCAGTT
>probe:Drosophila_2:1637417_at:304:415; Interrogation_Position=1573; Antisense; GAGCCGGCGCAAGGTCAATAGTAAA
>probe:Drosophila_2:1637417_at:292:115; Interrogation_Position=1603; Antisense; AGCAGGTCGTTAACTCCTTTACCAT
>probe:Drosophila_2:1637417_at:375:707; Interrogation_Position=1621; Antisense; TTACCATTATATACCTGGCTGCTCC
>probe:Drosophila_2:1637417_at:181:473; Interrogation_Position=1681; Antisense; GTATCAAACCATCCGAAAGCCCAGT
>probe:Drosophila_2:1637417_at:83:175; Interrogation_Position=1696; Antisense; AAAGCCCAGTTCCATCTTATGTTCA
>probe:Drosophila_2:1637417_at:402:645; Interrogation_Position=1718; Antisense; TCATCCCTTCGATCGGCTTTAAAAT
>probe:Drosophila_2:1637417_at:587:723; Interrogation_Position=1802; Antisense; TTGCTCTTAACATGAGTGCCACTTT

Paste this into a BLAST search page for me
GGCATACCCATACCGCAGAATATTATTAAGTCCTGGGTTACTCAGAAACAGTTCCTCACCAAGATGTACGTGGCCCTGCTCACGGGCCATCAAGATGAAGAAGGACATGTTTCACGGATTCGCGCCACGGATTCGCGCTTATCAATGACGACGGCTAATGAGCAACGCGGCAGTTGAGCCGGCGCAAGGTCAATAGTAAAAGCAGGTCGTTAACTCCTTTACCATTTACCATTATATACCTGGCTGCTCCGTATCAAACCATCCGAAAGCCCAGTAAAGCCCAGTTCCATCTTATGTTCATCATCCCTTCGATCGGCTTTAAAATTTGCTCTTAACATGAGTGCCACTTT

Full Affymetrix probeset data:

Annotations for 1637417_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime