FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637421_at:

>probe:Drosophila_2:1637421_at:56:451; Interrogation_Position=1064; Antisense; GATCTGCCAGACACTGAGCAACCAG
>probe:Drosophila_2:1637421_at:589:83; Interrogation_Position=1108; Antisense; AGTGGGATCCGCAAACCAGCCAGGT
>probe:Drosophila_2:1637421_at:553:579; Interrogation_Position=1135; Antisense; TGGCCAAGTCCGAGCGAAACGTCTT
>probe:Drosophila_2:1637421_at:686:389; Interrogation_Position=1150; Antisense; GAAACGTCTTCACCCAGGAGATCAA
>probe:Drosophila_2:1637421_at:437:161; Interrogation_Position=1210; Antisense; ACAAGGTGTTGTTCGCCATGTCCAA
>probe:Drosophila_2:1637421_at:707:555; Interrogation_Position=1271; Antisense; GGACGACTTCCTGGGTAACTGCAAG
>probe:Drosophila_2:1637421_at:536:557; Interrogation_Position=1316; Antisense; GGACTTCCAGAAGGTGACTGCCGCG
>probe:Drosophila_2:1637421_at:335:101; Interrogation_Position=1345; Antisense; AGAGATCGAGCCAGAACTATCCCCT
>probe:Drosophila_2:1637421_at:440:423; Interrogation_Position=1446; Antisense; GAGAACGAGATTCCGCACGGCAGCA
>probe:Drosophila_2:1637421_at:529:353; Interrogation_Position=1460; Antisense; GCACGGCAGCATAGCGGATCGCAAG
>probe:Drosophila_2:1637421_at:231:369; Interrogation_Position=1484; Antisense; GAATGCCGGCGCTTCTATGGTCAGT
>probe:Drosophila_2:1637421_at:2:681; Interrogation_Position=1499; Antisense; TATGGTCAGTCTGGGCCTCGGAGTC
>probe:Drosophila_2:1637421_at:76:337; Interrogation_Position=1577; Antisense; GCTCCGGTAGCCATAGTCTTAGAAA
>probe:Drosophila_2:1637421_at:603:151; Interrogation_Position=1603; Antisense; ACATCACCTTGTTCACGTAGTCATT

Paste this into a BLAST search page for me
GATCTGCCAGACACTGAGCAACCAGAGTGGGATCCGCAAACCAGCCAGGTTGGCCAAGTCCGAGCGAAACGTCTTGAAACGTCTTCACCCAGGAGATCAAACAAGGTGTTGTTCGCCATGTCCAAGGACGACTTCCTGGGTAACTGCAAGGGACTTCCAGAAGGTGACTGCCGCGAGAGATCGAGCCAGAACTATCCCCTGAGAACGAGATTCCGCACGGCAGCAGCACGGCAGCATAGCGGATCGCAAGGAATGCCGGCGCTTCTATGGTCAGTTATGGTCAGTCTGGGCCTCGGAGTCGCTCCGGTAGCCATAGTCTTAGAAAACATCACCTTGTTCACGTAGTCATT

Full Affymetrix probeset data:

Annotations for 1637421_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720