Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637422_at:

>probe:Drosophila_2:1637422_at:286:229; Interrogation_Position=1001; Antisense; AATGGAATCTCTAGCTTCTACCGCG
>probe:Drosophila_2:1637422_at:39:519; Interrogation_Position=1025; Antisense; GTGGGCAACATAACCGCTGGCATGG
>probe:Drosophila_2:1637422_at:581:175; Interrogation_Position=1056; Antisense; AAACGGTGTCGGTCGTTCTGCAAAT
>probe:Drosophila_2:1637422_at:138:155; Interrogation_Position=1136; Antisense; ACACGCGTCGGTCACGTACAATTTA
>probe:Drosophila_2:1637422_at:718:243; Interrogation_Position=1155; Antisense; AATTTACGGTTCAGCACATACGCGC
>probe:Drosophila_2:1637422_at:136:587; Interrogation_Position=1203; Antisense; TGGACACACGCAAGCGGGCGCAGAT
>probe:Drosophila_2:1637422_at:164:455; Interrogation_Position=1225; Antisense; GATCACCGATCTGCAGTTTGACATG
>probe:Drosophila_2:1637422_at:686:407; Interrogation_Position=1275; Antisense; GAGCGGGAACGCTGGACTACGTCAT
>probe:Drosophila_2:1637422_at:181:429; Interrogation_Position=1301; Antisense; GAGTTTGCGGTGAACGTCATTCCCA
>probe:Drosophila_2:1637422_at:399:623; Interrogation_Position=1332; Antisense; TGCGCTACCAGATCATGGACGCCAT
>probe:Drosophila_2:1637422_at:450:345; Interrogation_Position=1381; Antisense; GCAGGAGAAGTTCAACACCATCGAT
>probe:Drosophila_2:1637422_at:335:103; Interrogation_Position=1422; Antisense; AGACCATGGCTCAGAACAACTTCAA
>probe:Drosophila_2:1637422_at:128:519; Interrogation_Position=964; Antisense; GGGCGTGTTCAGTGTCCAGTTAGCA
>probe:Drosophila_2:1637422_at:720:475; Interrogation_Position=982; Antisense; GTTAGCACACACCTGGATCAATGGA

Paste this into a BLAST search page for me
AATGGAATCTCTAGCTTCTACCGCGGTGGGCAACATAACCGCTGGCATGGAAACGGTGTCGGTCGTTCTGCAAATACACGCGTCGGTCACGTACAATTTAAATTTACGGTTCAGCACATACGCGCTGGACACACGCAAGCGGGCGCAGATGATCACCGATCTGCAGTTTGACATGGAGCGGGAACGCTGGACTACGTCATGAGTTTGCGGTGAACGTCATTCCCATGCGCTACCAGATCATGGACGCCATGCAGGAGAAGTTCAACACCATCGATAGACCATGGCTCAGAACAACTTCAAGGGCGTGTTCAGTGTCCAGTTAGCAGTTAGCACACACCTGGATCAATGGA

Full Affymetrix probeset data:

Annotations for 1637422_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime