FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637423_at:

>probe:Drosophila_2:1637423_at:435:81; Interrogation_Position=263; Antisense; AGGGTCGCAGCATTGTTACTGGCCT
>probe:Drosophila_2:1637423_at:651:375; Interrogation_Position=302; Antisense; GAAGACTGCGACGAATGCGCGGCAA
>probe:Drosophila_2:1637423_at:262:425; Interrogation_Position=328; Antisense; GAGAGCATTTTCAAGAAGCCCGAAC
>probe:Drosophila_2:1637423_at:146:193; Interrogation_Position=350; Antisense; AACTCCCCATTGGACGCTGTTTGAA
>probe:Drosophila_2:1637423_at:100:461; Interrogation_Position=391; Antisense; GATTACCAGGTAAACCCGCACAAAT
>probe:Drosophila_2:1637423_at:181:211; Interrogation_Position=418; Antisense; AAGAAGTACTCCCTGTCTGATGTGG
>probe:Drosophila_2:1637423_at:693:519; Interrogation_Position=439; Antisense; GTGGACATTTCCGAACAGAGCAACT
>probe:Drosophila_2:1637423_at:35:503; Interrogation_Position=477; Antisense; GTCCTTCCTGCGACAAATGGATGCA
>probe:Drosophila_2:1637423_at:513:455; Interrogation_Position=523; Antisense; GATAACGAATCTCCACCTACAGATG
>probe:Drosophila_2:1637423_at:621:213; Interrogation_Position=562; Antisense; AAGAGGACCAGCAAACTCAGCCGCA
>probe:Drosophila_2:1637423_at:490:31; Interrogation_Position=632; Antisense; ATAAGCCGCAGTTAAGAGGTTCCAA
>probe:Drosophila_2:1637423_at:283:469; Interrogation_Position=650; Antisense; GTTCCAAGCTGGTGATGCCTGAGTA
>probe:Drosophila_2:1637423_at:104:319; Interrogation_Position=731; Antisense; GCCGTGCAGCGGGAAAACTACAACT
>probe:Drosophila_2:1637423_at:299:159; Interrogation_Position=750; Antisense; ACAACTGTCCCACTTGGCGGAGGAG

Paste this into a BLAST search page for me
AGGGTCGCAGCATTGTTACTGGCCTGAAGACTGCGACGAATGCGCGGCAAGAGAGCATTTTCAAGAAGCCCGAACAACTCCCCATTGGACGCTGTTTGAAGATTACCAGGTAAACCCGCACAAATAAGAAGTACTCCCTGTCTGATGTGGGTGGACATTTCCGAACAGAGCAACTGTCCTTCCTGCGACAAATGGATGCAGATAACGAATCTCCACCTACAGATGAAGAGGACCAGCAAACTCAGCCGCAATAAGCCGCAGTTAAGAGGTTCCAAGTTCCAAGCTGGTGATGCCTGAGTAGCCGTGCAGCGGGAAAACTACAACTACAACTGTCCCACTTGGCGGAGGAG

Full Affymetrix probeset data:

Annotations for 1637423_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720