Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637424_at:

>probe:Drosophila_2:1637424_at:294:147; Interrogation_Position=5491; Antisense; ACTACATGTCCACGCTGCTGGCCAA
>probe:Drosophila_2:1637424_at:65:581; Interrogation_Position=5509; Antisense; TGGCCAACAGCGGAGATGTCAATCT
>probe:Drosophila_2:1637424_at:400:99; Interrogation_Position=5522; Antisense; AGATGTCAATCTCTATGCCGTGGCC
>probe:Drosophila_2:1637424_at:363:681; Interrogation_Position=5535; Antisense; TATGCCGTGGCCATCGATCAGAGGC
>probe:Drosophila_2:1637424_at:128:35; Interrogation_Position=5551; Antisense; ATCAGAGGCCCTGCAATGGAACACA
>probe:Drosophila_2:1637424_at:248:109; Interrogation_Position=5575; Antisense; AGAAGATCTACCATCTGGACACGAT
>probe:Drosophila_2:1637424_at:330:559; Interrogation_Position=5591; Antisense; GGACACGATGCAGGCATTCAAGCAG
>probe:Drosophila_2:1637424_at:388:351; Interrogation_Position=5612; Antisense; GCAGAAGTTCAATATCTCCATGGAA
>probe:Drosophila_2:1637424_at:332:685; Interrogation_Position=5624; Antisense; TATCTCCATGGAAACGCTGTCTTCA
>probe:Drosophila_2:1637424_at:279:391; Interrogation_Position=5634; Antisense; GAAACGCTGTCTTCAGTGGCCACTT
>probe:Drosophila_2:1637424_at:384:149; Interrogation_Position=5655; Antisense; ACTTCTGTGACTTTGGGCTCGACTG
>probe:Drosophila_2:1637424_at:722:593; Interrogation_Position=5668; Antisense; TGGGCTCGACTGTCACCGGAAATAG
>probe:Drosophila_2:1637424_at:377:277; Interrogation_Position=5842; Antisense; CTTTTTCATGTGTAACGATTGCCTA
>probe:Drosophila_2:1637424_at:202:689; Interrogation_Position=5903; Antisense; TTACTCTTTAAATACTTTGTGCTGT

Paste this into a BLAST search page for me
ACTACATGTCCACGCTGCTGGCCAATGGCCAACAGCGGAGATGTCAATCTAGATGTCAATCTCTATGCCGTGGCCTATGCCGTGGCCATCGATCAGAGGCATCAGAGGCCCTGCAATGGAACACAAGAAGATCTACCATCTGGACACGATGGACACGATGCAGGCATTCAAGCAGGCAGAAGTTCAATATCTCCATGGAATATCTCCATGGAAACGCTGTCTTCAGAAACGCTGTCTTCAGTGGCCACTTACTTCTGTGACTTTGGGCTCGACTGTGGGCTCGACTGTCACCGGAAATAGCTTTTTCATGTGTAACGATTGCCTATTACTCTTTAAATACTTTGTGCTGT

Full Affymetrix probeset data:

Annotations for 1637424_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime