Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637426_at:

>probe:Drosophila_2:1637426_at:248:123; Interrogation_Position=1076; Antisense; AGCGCATCTTTACGGTAGCTGCCGA
>probe:Drosophila_2:1637426_at:114:487; Interrogation_Position=1090; Antisense; GTAGCTGCCGAAGCCATGGAGACGC
>probe:Drosophila_2:1637426_at:181:549; Interrogation_Position=1107; Antisense; GGAGACGCGCCAGACCAACGACGAG
>probe:Drosophila_2:1637426_at:115:91; Interrogation_Position=1136; Antisense; AGTATCTAAAGGAGCGAGACCGCGT
>probe:Drosophila_2:1637426_at:337:55; Interrogation_Position=1258; Antisense; ATGAAGCAGCGCCTTGCTCTGGAGA
>probe:Drosophila_2:1637426_at:298:429; Interrogation_Position=1300; Antisense; GAGTTCGCCAAGGTCATGGATCGCA
>probe:Drosophila_2:1637426_at:642:647; Interrogation_Position=1352; Antisense; TCATGGATCGTCAGCGGGACGCTCA
>probe:Drosophila_2:1637426_at:238:403; Interrogation_Position=1396; Antisense; GACTTGCGCCAACAGATGACAGACA
>probe:Drosophila_2:1637426_at:60:223; Interrogation_Position=1461; Antisense; AAGGGTGCAGAAGTGGCTCGACCAT
>probe:Drosophila_2:1637426_at:540:111; Interrogation_Position=1490; Antisense; AGCAGCGGGACGTTAACATCCAGCA
>probe:Drosophila_2:1637426_at:595:151; Interrogation_Position=1505; Antisense; ACATCCAGCAGGTGATTAACGCCAA
>probe:Drosophila_2:1637426_at:279:709; Interrogation_Position=1520; Antisense; TTAACGCCAAGATCGCGGCTATGCG
>probe:Drosophila_2:1637426_at:180:625; Interrogation_Position=1541; Antisense; TGCGCGACAATTGCCTACCGGAGAA
>probe:Drosophila_2:1637426_at:188:377; Interrogation_Position=1593; Antisense; GAAGAACATCCAAAGTTCCCGCAAC

Paste this into a BLAST search page for me
AGCGCATCTTTACGGTAGCTGCCGAGTAGCTGCCGAAGCCATGGAGACGCGGAGACGCGCCAGACCAACGACGAGAGTATCTAAAGGAGCGAGACCGCGTATGAAGCAGCGCCTTGCTCTGGAGAGAGTTCGCCAAGGTCATGGATCGCATCATGGATCGTCAGCGGGACGCTCAGACTTGCGCCAACAGATGACAGACAAAGGGTGCAGAAGTGGCTCGACCATAGCAGCGGGACGTTAACATCCAGCAACATCCAGCAGGTGATTAACGCCAATTAACGCCAAGATCGCGGCTATGCGTGCGCGACAATTGCCTACCGGAGAAGAAGAACATCCAAAGTTCCCGCAAC

Full Affymetrix probeset data:

Annotations for 1637426_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime