FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637429_at:

>probe:Drosophila_2:1637429_at:415:319; Interrogation_Position=259; Antisense; GCCCACGTTCGTGCGGAATGTGATG
>probe:Drosophila_2:1637429_at:549:523; Interrogation_Position=301; Antisense; GGGTTCCGGCGAGTTCCATGTGTAC
>probe:Drosophila_2:1637429_at:365:63; Interrogation_Position=318; Antisense; ATGTGTACCGCCACTTGCGACGCAA
>probe:Drosophila_2:1637429_at:669:89; Interrogation_Position=345; Antisense; AGTACGCCCGCCAGAAGAACATCCA
>probe:Drosophila_2:1637429_at:473:107; Interrogation_Position=360; Antisense; AGAACATCCAGAACCAGAGTGCCCG
>probe:Drosophila_2:1637429_at:372:101; Interrogation_Position=375; Antisense; AGAGTGCCCGCGAAGCAGCAGATGA
>probe:Drosophila_2:1637429_at:79:557; Interrogation_Position=418; Antisense; GGACGACAACAGACGCGCGGCCGAA
>probe:Drosophila_2:1637429_at:722:379; Interrogation_Position=514; Antisense; GAAGCCACTGGCTAAGGAAGCCTCA
>probe:Drosophila_2:1637429_at:700:95; Interrogation_Position=553; Antisense; AGATTCCGAGGAAGAGCCCACAGAA
>probe:Drosophila_2:1637429_at:216:341; Interrogation_Position=617; Antisense; GCATCCAAGGAATCCGACGACAATA
>probe:Drosophila_2:1637429_at:387:397; Interrogation_Position=632; Antisense; GACGACAATAACACCCAAGAAACTT
>probe:Drosophila_2:1637429_at:61:347; Interrogation_Position=729; Antisense; GCACCGAAGCTACAAAGGAATCCCA
>probe:Drosophila_2:1637429_at:414:209; Interrogation_Position=771; Antisense; AAGACAAGCCTGTGCCTTAGTACCT
>probe:Drosophila_2:1637429_at:651:703; Interrogation_Position=787; Antisense; TTAGTACCTCCTGTTCTATTCCTAT

Paste this into a BLAST search page for me
GCCCACGTTCGTGCGGAATGTGATGGGGTTCCGGCGAGTTCCATGTGTACATGTGTACCGCCACTTGCGACGCAAAGTACGCCCGCCAGAAGAACATCCAAGAACATCCAGAACCAGAGTGCCCGAGAGTGCCCGCGAAGCAGCAGATGAGGACGACAACAGACGCGCGGCCGAAGAAGCCACTGGCTAAGGAAGCCTCAAGATTCCGAGGAAGAGCCCACAGAAGCATCCAAGGAATCCGACGACAATAGACGACAATAACACCCAAGAAACTTGCACCGAAGCTACAAAGGAATCCCAAAGACAAGCCTGTGCCTTAGTACCTTTAGTACCTCCTGTTCTATTCCTAT

Full Affymetrix probeset data:

Annotations for 1637429_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720