Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637430_s_at:

>probe:Drosophila_2:1637430_s_at:200:679; Interrogation_Position=385; Antisense; TAGGAACGTTCTGTTTACTCCTCGC
>probe:Drosophila_2:1637430_s_at:447:111; Interrogation_Position=426; Antisense; AGCACGGGCGGCATTATTGCCAAGA
>probe:Drosophila_2:1637430_s_at:463:721; Interrogation_Position=442; Antisense; TTGCCAAGACGATCTATGAGCTGAT
>probe:Drosophila_2:1637430_s_at:475:609; Interrogation_Position=458; Antisense; TGAGCTGATTTACCACAGTGTGGCC
>probe:Drosophila_2:1637430_s_at:679:283; Interrogation_Position=513; Antisense; CTGCTGCTCAAGCTGCGCGATGTAA
>probe:Drosophila_2:1637430_s_at:322:599; Interrogation_Position=533; Antisense; TGTAAAGCACGACGCCTATATGGCA
>probe:Drosophila_2:1637430_s_at:361:25; Interrogation_Position=550; Antisense; ATATGGCAGCCGGTGTTTTGGGCCT
>probe:Drosophila_2:1637430_s_at:54:495; Interrogation_Position=576; Antisense; GTCAATGCGGTGCTGTACTTCATCA
>probe:Drosophila_2:1637430_s_at:385:47; Interrogation_Position=620; Antisense; ATCCTATCGCGGCATTTAAGCACTA
>probe:Drosophila_2:1637430_s_at:528:635; Interrogation_Position=696; Antisense; TCGAAGCATTTGTTCTTCCCACAAC
>probe:Drosophila_2:1637430_s_at:416:193; Interrogation_Position=722; Antisense; AACTCTAGCCACTGGTCATGCGAAG
>probe:Drosophila_2:1637430_s_at:365:331; Interrogation_Position=809; Antisense; GCGGCGGAATCTTTGTTGTACTGTG
>probe:Drosophila_2:1637430_s_at:365:383; Interrogation_Position=833; Antisense; GAAACGTTCTTTGGCGCTAGTTACA
>probe:Drosophila_2:1637430_s_at:161:497; Interrogation_Position=899; Antisense; GTCTCACTTTCTTTTGTACCAAACA

Paste this into a BLAST search page for me
TAGGAACGTTCTGTTTACTCCTCGCAGCACGGGCGGCATTATTGCCAAGATTGCCAAGACGATCTATGAGCTGATTGAGCTGATTTACCACAGTGTGGCCCTGCTGCTCAAGCTGCGCGATGTAATGTAAAGCACGACGCCTATATGGCAATATGGCAGCCGGTGTTTTGGGCCTGTCAATGCGGTGCTGTACTTCATCAATCCTATCGCGGCATTTAAGCACTATCGAAGCATTTGTTCTTCCCACAACAACTCTAGCCACTGGTCATGCGAAGGCGGCGGAATCTTTGTTGTACTGTGGAAACGTTCTTTGGCGCTAGTTACAGTCTCACTTTCTTTTGTACCAAACA

Full Affymetrix probeset data:

Annotations for 1637430_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime