FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637431_at:

>probe:Drosophila_2:1637431_at:508:617; Interrogation_Position=122; Antisense; TGCAGCGCAATGTCAACTTCAACGA
>probe:Drosophila_2:1637431_at:696:53; Interrogation_Position=13; Antisense; ATGAGCCAAAACCTCCAAGTGAGCT
>probe:Drosophila_2:1637431_at:279:231; Interrogation_Position=130; Antisense; AATGTCAACTTCAACGAGGACCTCA
>probe:Drosophila_2:1637431_at:385:75; Interrogation_Position=146; Antisense; AGGACCTCAACGACCTGGCCGGCTA
>probe:Drosophila_2:1637431_at:698:219; Interrogation_Position=217; Antisense; AAGTCCATTTTCCAGCGACCGCGTT
>probe:Drosophila_2:1637431_at:577:411; Interrogation_Position=233; Antisense; GACCGCGTTCCATGTCCGTTTGGAG
>probe:Drosophila_2:1637431_at:294:293; Interrogation_Position=238; Antisense; CGTTCCATGTCCGTTTGGAGTGACA
>probe:Drosophila_2:1637431_at:428:481; Interrogation_Position=250; Antisense; GTTTGGAGTGACATCAGTCGCAGCA
>probe:Drosophila_2:1637431_at:689:35; Interrogation_Position=262; Antisense; ATCAGTCGCAGCAGTATGCGTCTGG
>probe:Drosophila_2:1637431_at:202:353; Interrogation_Position=269; Antisense; GCAGCAGTATGCGTCTGGATGAAAG
>probe:Drosophila_2:1637431_at:39:221; Interrogation_Position=29; Antisense; AAGTGAGCTACACCGCTTTGGCCAT
>probe:Drosophila_2:1637431_at:4:133; Interrogation_Position=40; Antisense; ACCGCTTTGGCCATGTCGGACGATA
>probe:Drosophila_2:1637431_at:241:289; Interrogation_Position=56; Antisense; CGGACGATAATCAAACCTGCAGCTA
>probe:Drosophila_2:1637431_at:559:239; Interrogation_Position=64; Antisense; AATCAAACCTGCAGCTACTCGATGC

Paste this into a BLAST search page for me
TGCAGCGCAATGTCAACTTCAACGAATGAGCCAAAACCTCCAAGTGAGCTAATGTCAACTTCAACGAGGACCTCAAGGACCTCAACGACCTGGCCGGCTAAAGTCCATTTTCCAGCGACCGCGTTGACCGCGTTCCATGTCCGTTTGGAGCGTTCCATGTCCGTTTGGAGTGACAGTTTGGAGTGACATCAGTCGCAGCAATCAGTCGCAGCAGTATGCGTCTGGGCAGCAGTATGCGTCTGGATGAAAGAAGTGAGCTACACCGCTTTGGCCATACCGCTTTGGCCATGTCGGACGATACGGACGATAATCAAACCTGCAGCTAAATCAAACCTGCAGCTACTCGATGC

Full Affymetrix probeset data:

Annotations for 1637431_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720