FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637432_at:

>probe:Drosophila_2:1637432_at:121:725; Interrogation_Position=1399; Antisense; TTGACCTTCCACAGCTACGGACAGA
>probe:Drosophila_2:1637432_at:301:59; Interrogation_Position=1423; Antisense; ATGATTGTTTATCCGTGGGCCTACA
>probe:Drosophila_2:1637432_at:216:225; Interrogation_Position=1462; Antisense; AAGGATGCCAGTGTCCTGCAGCGAG
>probe:Drosophila_2:1637432_at:25:417; Interrogation_Position=1504; Antisense; GAGCGAATCCTCCAGAAGACGGGCA
>probe:Drosophila_2:1637432_at:655:211; Interrogation_Position=1519; Antisense; AAGACGGGCACTTCGTACAGGGCAG
>probe:Drosophila_2:1637432_at:501:353; Interrogation_Position=1540; Antisense; GCAGCGGTCACCCATGAAGTTTTGG
>probe:Drosophila_2:1637432_at:189:323; Interrogation_Position=1598; Antisense; GCGCCGCGCTTGGTGTCAAATATGT
>probe:Drosophila_2:1637432_at:98:515; Interrogation_Position=1621; Antisense; GTGTACACCATCGAGCTGAGGGATC
>probe:Drosophila_2:1637432_at:173:585; Interrogation_Position=1647; Antisense; TGGAGCCTACGGATTTGTCCTGCCG
>probe:Drosophila_2:1637432_at:455:479; Interrogation_Position=1676; Antisense; GTTTCATCAAGGACACAGCTCTCGA
>probe:Drosophila_2:1637432_at:85:319; Interrogation_Position=1778; Antisense; GCCGAGTCTCGGTGTAATTTGTAAA
>probe:Drosophila_2:1637432_at:709:517; Interrogation_Position=1928; Antisense; GTGGGCTGCTGTATCCTTTGAATCC
>probe:Drosophila_2:1637432_at:430:277; Interrogation_Position=1943; Antisense; CTTTGAATCCTGTACGGCGGGCAAT
>probe:Drosophila_2:1637432_at:420:367; Interrogation_Position=1972; Antisense; GAATCCTCGCTATTTATTACTACAC

Paste this into a BLAST search page for me
TTGACCTTCCACAGCTACGGACAGAATGATTGTTTATCCGTGGGCCTACAAAGGATGCCAGTGTCCTGCAGCGAGGAGCGAATCCTCCAGAAGACGGGCAAAGACGGGCACTTCGTACAGGGCAGGCAGCGGTCACCCATGAAGTTTTGGGCGCCGCGCTTGGTGTCAAATATGTGTGTACACCATCGAGCTGAGGGATCTGGAGCCTACGGATTTGTCCTGCCGGTTTCATCAAGGACACAGCTCTCGAGCCGAGTCTCGGTGTAATTTGTAAAGTGGGCTGCTGTATCCTTTGAATCCCTTTGAATCCTGTACGGCGGGCAATGAATCCTCGCTATTTATTACTACAC

Full Affymetrix probeset data:

Annotations for 1637432_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720