FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637433_at:

>probe:Drosophila_2:1637433_at:109:609; Interrogation_Position=128; Antisense; TGACCGGATCCACAATAGCATTAGC
>probe:Drosophila_2:1637433_at:104:67; Interrogation_Position=13; Antisense; ATGGACCAGCGCAATCTAACACTGC
>probe:Drosophila_2:1637433_at:536:185; Interrogation_Position=177; Antisense; AACAACGACGCCAGCCACATTTTTT
>probe:Drosophila_2:1637433_at:408:259; Interrogation_Position=188; Antisense; CAGCCACATTTTTTACCTACAGCAT
>probe:Drosophila_2:1637433_at:170:675; Interrogation_Position=212; Antisense; TACCAGGCATGGACATTGCGCCAGG
>probe:Drosophila_2:1637433_at:157:557; Interrogation_Position=222; Antisense; GGACATTGCGCCAGGACCATTTATA
>probe:Drosophila_2:1637433_at:250:555; Interrogation_Position=235; Antisense; GGACCATTTATATTCACCTACGTTA
>probe:Drosophila_2:1637433_at:142:363; Interrogation_Position=262; Antisense; GAATTTTTATCGCTTATCACGCCCG
>probe:Drosophila_2:1637433_at:226:705; Interrogation_Position=275; Antisense; TTATCACGCCCGAGGAATTGCCGCT
>probe:Drosophila_2:1637433_at:17:71; Interrogation_Position=287; Antisense; AGGAATTGCCGCTGGGTAAGTCCCT
>probe:Drosophila_2:1637433_at:521:265; Interrogation_Position=328; Antisense; CAGAGGGCGTGGTCCTGCATCCTTG
>probe:Drosophila_2:1637433_at:621:185; Interrogation_Position=54; Antisense; AACAATTATGTCCTCGTCATCAGCA
>probe:Drosophila_2:1637433_at:425:647; Interrogation_Position=70; Antisense; TCATCAGCAGCGATGTCGGCGGGCT
>probe:Drosophila_2:1637433_at:279:569; Interrogation_Position=91; Antisense; GGCTTCGCATCCCTTGGAGGACCCA

Paste this into a BLAST search page for me
TGACCGGATCCACAATAGCATTAGCATGGACCAGCGCAATCTAACACTGCAACAACGACGCCAGCCACATTTTTTCAGCCACATTTTTTACCTACAGCATTACCAGGCATGGACATTGCGCCAGGGGACATTGCGCCAGGACCATTTATAGGACCATTTATATTCACCTACGTTAGAATTTTTATCGCTTATCACGCCCGTTATCACGCCCGAGGAATTGCCGCTAGGAATTGCCGCTGGGTAAGTCCCTCAGAGGGCGTGGTCCTGCATCCTTGAACAATTATGTCCTCGTCATCAGCATCATCAGCAGCGATGTCGGCGGGCTGGCTTCGCATCCCTTGGAGGACCCA

Full Affymetrix probeset data:

Annotations for 1637433_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720