FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637434_at:

>probe:Drosophila_2:1637434_at:577:703; Interrogation_Position=108; Antisense; TTATCCCTATTACGGCGGCGCTAAT
>probe:Drosophila_2:1637434_at:578:495; Interrogation_Position=15; Antisense; GTCAGTGAAACAGTCGAGCCGCTCT
>probe:Drosophila_2:1637434_at:495:1; Interrogation_Position=150; Antisense; ATACGGGAACATATACGGCAGCGGC
>probe:Drosophila_2:1637434_at:201:353; Interrogation_Position=167; Antisense; GCAGCGGCATGTACGGATACCCCTA
>probe:Drosophila_2:1637434_at:25:27; Interrogation_Position=183; Antisense; ATACCCCTACAGCTACGGCGGATAT
>probe:Drosophila_2:1637434_at:615:287; Interrogation_Position=198; Antisense; CGGCGGATATCCGTACTACTCGTAT
>probe:Drosophila_2:1637434_at:223:455; Interrogation_Position=254; Antisense; GATACGGGCAGTACGGATACCCCTA
>probe:Drosophila_2:1637434_at:225:455; Interrogation_Position=269; Antisense; GATACCCCTATGGAGGATATCCCTA
>probe:Drosophila_2:1637434_at:41:79; Interrogation_Position=282; Antisense; AGGATATCCCTACGGCGGCAATGGC
>probe:Drosophila_2:1637434_at:143:415; Interrogation_Position=30; Antisense; GAGCCGCTCTCCATGTTGTTGGTTC
>probe:Drosophila_2:1637434_at:176:227; Interrogation_Position=301; Antisense; AATGGCATGAACGTGGCCTACGCCA
>probe:Drosophila_2:1637434_at:628:351; Interrogation_Position=326; Antisense; GCAGCAGTGGAGGATTCGCAACAGC
>probe:Drosophila_2:1637434_at:507:723; Interrogation_Position=45; Antisense; TTGTTGGTTCGGTTTGCTCCTGGTC
>probe:Drosophila_2:1637434_at:586:413; Interrogation_Position=93; Antisense; GAGCCAATACTACGGTTATCCCTAT

Paste this into a BLAST search page for me
TTATCCCTATTACGGCGGCGCTAATGTCAGTGAAACAGTCGAGCCGCTCTATACGGGAACATATACGGCAGCGGCGCAGCGGCATGTACGGATACCCCTAATACCCCTACAGCTACGGCGGATATCGGCGGATATCCGTACTACTCGTATGATACGGGCAGTACGGATACCCCTAGATACCCCTATGGAGGATATCCCTAAGGATATCCCTACGGCGGCAATGGCGAGCCGCTCTCCATGTTGTTGGTTCAATGGCATGAACGTGGCCTACGCCAGCAGCAGTGGAGGATTCGCAACAGCTTGTTGGTTCGGTTTGCTCCTGGTCGAGCCAATACTACGGTTATCCCTAT

Full Affymetrix probeset data:

Annotations for 1637434_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720