Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637435_at:

>probe:Drosophila_2:1637435_at:53:543; Interrogation_Position=1914; Antisense; GGATTCCCGGCAGAGTTCCTTGCAA
>probe:Drosophila_2:1637435_at:475:719; Interrogation_Position=1929; Antisense; TTCCTTGCAATCAACAGGCTGCTCA
>probe:Drosophila_2:1637435_at:700:235; Interrogation_Position=1968; Antisense; AATCGATGAACTCCAACCGGACCTT
>probe:Drosophila_2:1637435_at:345:627; Interrogation_Position=1999; Antisense; TCCACTCAACCTACTGCCTTAAAAA
>probe:Drosophila_2:1637435_at:82:657; Interrogation_Position=2028; Antisense; TAATGAAACTTTCGGTCCATCAGCG
>probe:Drosophila_2:1637435_at:446:351; Interrogation_Position=2059; Antisense; GCAGAAGTTAATCCCCGAAGCAAGT
>probe:Drosophila_2:1637435_at:51:301; Interrogation_Position=2158; Antisense; CCCATTACTGGTGTTGATATCTCAA
>probe:Drosophila_2:1637435_at:623:241; Interrogation_Position=2204; Antisense; AATATGGCATTTCCCACCATACACA
>probe:Drosophila_2:1637435_at:628:665; Interrogation_Position=2223; Antisense; TACACAGCTGCGAATCCACCGTAAA
>probe:Drosophila_2:1637435_at:214:301; Interrogation_Position=2241; Antisense; CCGTAAACCCCATGCCATTGAAATT
>probe:Drosophila_2:1637435_at:701:241; Interrogation_Position=2262; Antisense; AATTTTAGTCTTTGCCAGGATTTCA
>probe:Drosophila_2:1637435_at:696:673; Interrogation_Position=2302; Antisense; TACCTCTCTAAGACCTCCAGGAGAT
>probe:Drosophila_2:1637435_at:55:23; Interrogation_Position=2358; Antisense; ATATACCTCGCCTTATTTCTGGTAG
>probe:Drosophila_2:1637435_at:366:599; Interrogation_Position=2443; Antisense; TGTTTTAACCCACGCACTTTAAGTG

Paste this into a BLAST search page for me
GGATTCCCGGCAGAGTTCCTTGCAATTCCTTGCAATCAACAGGCTGCTCAAATCGATGAACTCCAACCGGACCTTTCCACTCAACCTACTGCCTTAAAAATAATGAAACTTTCGGTCCATCAGCGGCAGAAGTTAATCCCCGAAGCAAGTCCCATTACTGGTGTTGATATCTCAAAATATGGCATTTCCCACCATACACATACACAGCTGCGAATCCACCGTAAACCGTAAACCCCATGCCATTGAAATTAATTTTAGTCTTTGCCAGGATTTCATACCTCTCTAAGACCTCCAGGAGATATATACCTCGCCTTATTTCTGGTAGTGTTTTAACCCACGCACTTTAAGTG

Full Affymetrix probeset data:

Annotations for 1637435_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime