Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637437_at:

>probe:Drosophila_2:1637437_at:229:599; Interrogation_Position=1433; Antisense; TGTCCCGTGTGCAAGCGAGGCTTTA
>probe:Drosophila_2:1637437_at:592:317; Interrogation_Position=1499; Antisense; GCCGAAATCTACGAGTGCACTGTAT
>probe:Drosophila_2:1637437_at:401:535; Interrogation_Position=1570; Antisense; GGTGCATTCAGATACACGGCAATTT
>probe:Drosophila_2:1637437_at:439:373; Interrogation_Position=1601; Antisense; GAAGTCTGCGGATCGGCGTTCAAGC
>probe:Drosophila_2:1637437_at:612:105; Interrogation_Position=1632; Antisense; AGACACTGAAGGCACATCTCATCCT
>probe:Drosophila_2:1637437_at:503:305; Interrogation_Position=1662; Antisense; CCGGCATCCGGCCATATAAGTGCAA
>probe:Drosophila_2:1637437_at:289:213; Interrogation_Position=1696; Antisense; AAGAGACTTCGCCAATGGCTCCAAC
>probe:Drosophila_2:1637437_at:644:597; Interrogation_Position=1721; Antisense; TGTCGATCGCACAAACGGCAGGCAC
>probe:Drosophila_2:1637437_at:166:379; Interrogation_Position=1769; Antisense; GAAGCTCGCGGAGTGACACGATCCA
>probe:Drosophila_2:1637437_at:619:255; Interrogation_Position=1792; Antisense; CACACTTCTTCCAATGCTGGACGAA
>probe:Drosophila_2:1637437_at:626:383; Interrogation_Position=1814; Antisense; GAACTGACAATTGCGTCCAAGCTTT
>probe:Drosophila_2:1637437_at:455:157; Interrogation_Position=1844; Antisense; ACACCCGCAGGTCCTTGCAAAGTAA
>probe:Drosophila_2:1637437_at:468:173; Interrogation_Position=1883; Antisense; AAAGCTGCGCCCAAAGATCAAGATA
>probe:Drosophila_2:1637437_at:489:65; Interrogation_Position=1938; Antisense; ATGGTGCCATCCTCTACGAGCTGGT

Paste this into a BLAST search page for me
TGTCCCGTGTGCAAGCGAGGCTTTAGCCGAAATCTACGAGTGCACTGTATGGTGCATTCAGATACACGGCAATTTGAAGTCTGCGGATCGGCGTTCAAGCAGACACTGAAGGCACATCTCATCCTCCGGCATCCGGCCATATAAGTGCAAAAGAGACTTCGCCAATGGCTCCAACTGTCGATCGCACAAACGGCAGGCACGAAGCTCGCGGAGTGACACGATCCACACACTTCTTCCAATGCTGGACGAAGAACTGACAATTGCGTCCAAGCTTTACACCCGCAGGTCCTTGCAAAGTAAAAAGCTGCGCCCAAAGATCAAGATAATGGTGCCATCCTCTACGAGCTGGT

Full Affymetrix probeset data:

Annotations for 1637437_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime