Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637438_at:

>probe:Drosophila_2:1637438_at:184:307; Interrogation_Position=1652; Antisense; CCTGCGTGATGAAGACCTGCTGGAA
>probe:Drosophila_2:1637438_at:433:213; Interrogation_Position=1663; Antisense; AAGACCTGCTGGAAGAGCCTGCCGC
>probe:Drosophila_2:1637438_at:307:319; Interrogation_Position=1686; Antisense; GCCCTTTCGACTGGTTGGCGATAGA
>probe:Drosophila_2:1637438_at:496:541; Interrogation_Position=1698; Antisense; GGTTGGCGATAGACTCATGCTGAAG
>probe:Drosophila_2:1637438_at:100:313; Interrogation_Position=1732; Antisense; GCCAAAACTGTTCAAGCCGTCAAAG
>probe:Drosophila_2:1637438_at:170:107; Interrogation_Position=1786; Antisense; AGAAAGAAGCATGCCGGCACCGCTC
>probe:Drosophila_2:1637438_at:216:391; Interrogation_Position=1818; Antisense; GAAACCGGTCCTCGATTGGCCGAAG
>probe:Drosophila_2:1637438_at:139:379; Interrogation_Position=1839; Antisense; GAAGCGCATGGAGCTGATCTACCTG
>probe:Drosophila_2:1637438_at:145:309; Interrogation_Position=1874; Antisense; CCAACTACTGCGAGCGAAGTCTGCA
>probe:Drosophila_2:1637438_at:562:351; Interrogation_Position=1995; Antisense; GCAGCACATTCGAAGGACCACGCAG
>probe:Drosophila_2:1637438_at:324:247; Interrogation_Position=2030; Antisense; AATTCCGCTGGTGCTGCGAGGTCAA
>probe:Drosophila_2:1637438_at:446:241; Interrogation_Position=2096; Antisense; AATAGACGGGTAGCGGGAGCATATC
>probe:Drosophila_2:1637438_at:263:635; Interrogation_Position=2119; Antisense; TCGCTAGAACTAGGGCTATGTCATA
>probe:Drosophila_2:1637438_at:511:481; Interrogation_Position=2175; Antisense; GTATTACAACCGCAGATACGCACCG

Paste this into a BLAST search page for me
CCTGCGTGATGAAGACCTGCTGGAAAAGACCTGCTGGAAGAGCCTGCCGCGCCCTTTCGACTGGTTGGCGATAGAGGTTGGCGATAGACTCATGCTGAAGGCCAAAACTGTTCAAGCCGTCAAAGAGAAAGAAGCATGCCGGCACCGCTCGAAACCGGTCCTCGATTGGCCGAAGGAAGCGCATGGAGCTGATCTACCTGCCAACTACTGCGAGCGAAGTCTGCAGCAGCACATTCGAAGGACCACGCAGAATTCCGCTGGTGCTGCGAGGTCAAAATAGACGGGTAGCGGGAGCATATCTCGCTAGAACTAGGGCTATGTCATAGTATTACAACCGCAGATACGCACCG

Full Affymetrix probeset data:

Annotations for 1637438_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime