FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637440_at:

>probe:Drosophila_2:1637440_at:650:149; Interrogation_Position=301; Antisense; ACAGGGTCAAGGGAACGCACTCGGA
>probe:Drosophila_2:1637440_at:725:135; Interrogation_Position=315; Antisense; ACGCACTCGGAGATCTGTATGGAAT
>probe:Drosophila_2:1637440_at:611:365; Interrogation_Position=346; Antisense; GAATAAGGCATCTGCAACCGCTCAG
>probe:Drosophila_2:1637440_at:684:689; Interrogation_Position=419; Antisense; TTTGGCGATGACACCATGGTCTCTA
>probe:Drosophila_2:1637440_at:120:279; Interrogation_Position=441; Antisense; CTACCATCGGAATCTCCATCTGAAT
>probe:Drosophila_2:1637440_at:631:363; Interrogation_Position=477; Antisense; GAATCCCAAATCTCAGGTTACACCA
>probe:Drosophila_2:1637440_at:644:131; Interrogation_Position=514; Antisense; ACCGAACGGTGCCTGGTTACGAGCT
>probe:Drosophila_2:1637440_at:314:473; Interrogation_Position=529; Antisense; GTTACGAGCTCCTTTCGCAAAGTAG
>probe:Drosophila_2:1637440_at:54:115; Interrogation_Position=564; Antisense; AGCAGACAAAATCCCTACGCGTATC
>probe:Drosophila_2:1637440_at:255:403; Interrogation_Position=597; Antisense; GACTTCCTCTGGGAGATCTACGTGC
>probe:Drosophila_2:1637440_at:306:37; Interrogation_Position=612; Antisense; ATCTACGTGCCCATCCATAGTGGAG
>probe:Drosophila_2:1637440_at:460:435; Interrogation_Position=642; Antisense; GAGGAGGACATCCAGACCGTTCATG
>probe:Drosophila_2:1637440_at:300:331; Interrogation_Position=683; Antisense; GCTGGCCAGCGAGATGCATTTAATC
>probe:Drosophila_2:1637440_at:372:555; Interrogation_Position=720; Antisense; GGACCAGTGATCTATCTAATTGCAT

Paste this into a BLAST search page for me
ACAGGGTCAAGGGAACGCACTCGGAACGCACTCGGAGATCTGTATGGAATGAATAAGGCATCTGCAACCGCTCAGTTTGGCGATGACACCATGGTCTCTACTACCATCGGAATCTCCATCTGAATGAATCCCAAATCTCAGGTTACACCAACCGAACGGTGCCTGGTTACGAGCTGTTACGAGCTCCTTTCGCAAAGTAGAGCAGACAAAATCCCTACGCGTATCGACTTCCTCTGGGAGATCTACGTGCATCTACGTGCCCATCCATAGTGGAGGAGGAGGACATCCAGACCGTTCATGGCTGGCCAGCGAGATGCATTTAATCGGACCAGTGATCTATCTAATTGCAT

Full Affymetrix probeset data:

Annotations for 1637440_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720