FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637441_at:

>probe:Drosophila_2:1637441_at:654:357; Interrogation_Position=1001; Antisense; GCAACATCAGTCTCCTCTGAATGGA
>probe:Drosophila_2:1637441_at:169:639; Interrogation_Position=1016; Antisense; TCTGAATGGATATCCCTCTCAGCCG
>probe:Drosophila_2:1637441_at:262:233; Interrogation_Position=1044; Antisense; AATGCGGTTGCTCCGCAGGCAACTA
>probe:Drosophila_2:1637441_at:482:191; Interrogation_Position=1064; Antisense; AACTATGCCAACCACCGGAGGAGGA
>probe:Drosophila_2:1637441_at:616:359; Interrogation_Position=1107; Antisense; GCAACTGGCGGCAGTAATGCACCCA
>probe:Drosophila_2:1637441_at:553:331; Interrogation_Position=1161; Antisense; GCGGAAGCCGAGATGTGCACCACAT
>probe:Drosophila_2:1637441_at:42:195; Interrogation_Position=1191; Antisense; AACTGCCAGACCACGATCTATTTAG
>probe:Drosophila_2:1637441_at:629:255; Interrogation_Position=1202; Antisense; CACGATCTATTTAGTACGGTCCCCG
>probe:Drosophila_2:1637441_at:709:501; Interrogation_Position=1220; Antisense; GTCCCCGGAACTTGGACACGGCGAT
>probe:Drosophila_2:1637441_at:683:447; Interrogation_Position=1242; Antisense; GATGCCGGTTTACCTGTCCAGTAAA
>probe:Drosophila_2:1637441_at:230:39; Interrogation_Position=1274; Antisense; ATCTCCGCCGAGTGAAATGCACCAA
>probe:Drosophila_2:1637441_at:503:509; Interrogation_Position=1306; Antisense; GTGCATACTTCTGTTGTTTCATCAT
>probe:Drosophila_2:1637441_at:656:233; Interrogation_Position=890; Antisense; AATGCCACCGCAAACTGGCTACGAG
>probe:Drosophila_2:1637441_at:622:513; Interrogation_Position=930; Antisense; GTGATTCAACCAGATGCACAAATGC

Paste this into a BLAST search page for me
GCAACATCAGTCTCCTCTGAATGGATCTGAATGGATATCCCTCTCAGCCGAATGCGGTTGCTCCGCAGGCAACTAAACTATGCCAACCACCGGAGGAGGAGCAACTGGCGGCAGTAATGCACCCAGCGGAAGCCGAGATGTGCACCACATAACTGCCAGACCACGATCTATTTAGCACGATCTATTTAGTACGGTCCCCGGTCCCCGGAACTTGGACACGGCGATGATGCCGGTTTACCTGTCCAGTAAAATCTCCGCCGAGTGAAATGCACCAAGTGCATACTTCTGTTGTTTCATCATAATGCCACCGCAAACTGGCTACGAGGTGATTCAACCAGATGCACAAATGC

Full Affymetrix probeset data:

Annotations for 1637441_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720