Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637447_at:

>probe:Drosophila_2:1637447_at:360:271; Interrogation_Position=205; Antisense; CATCGAATCGGTCTGCTTCTGGTTC
>probe:Drosophila_2:1637447_at:659:601; Interrogation_Position=259; Antisense; TGCTTTGTCCGCGTGAATGTCAGTG
>probe:Drosophila_2:1637447_at:727:603; Interrogation_Position=300; Antisense; TGATCATCGAATCGCCGAGGTGCTG
>probe:Drosophila_2:1637447_at:213:39; Interrogation_Position=328; Antisense; ATCTGCGAACTGGACTTTGGCTACA
>probe:Drosophila_2:1637447_at:228:465; Interrogation_Position=386; Antisense; GATTGCGCTACGATGACCTGGAGAT
>probe:Drosophila_2:1637447_at:40:199; Interrogation_Position=424; Antisense; AACGATGTCTCTAACCTGAACTTCA
>probe:Drosophila_2:1637447_at:522:143; Interrogation_Position=465; Antisense; ACTGTGGCGCGATAACTGTGTTAAC
>probe:Drosophila_2:1637447_at:497:221; Interrogation_Position=532; Antisense; AAGGTCGAACTGTACAACGCACTGC
>probe:Drosophila_2:1637447_at:129:199; Interrogation_Position=547; Antisense; AACGCACTGCAGTTGGAGGCCAAGC
>probe:Drosophila_2:1637447_at:460:387; Interrogation_Position=621; Antisense; GAAAATCGGCATCATGGAGCGGCAT
>probe:Drosophila_2:1637447_at:449:347; Interrogation_Position=642; Antisense; GCATGGCGTTGTTTATCCCTGGCAA
>probe:Drosophila_2:1637447_at:690:583; Interrogation_Position=661; Antisense; TGGCAATTGAATCATTCGCTCCCGT
>probe:Drosophila_2:1637447_at:40:471; Interrogation_Position=684; Antisense; GTTCGTTTCGCAATCGCCAACTGAA
>probe:Drosophila_2:1637447_at:719:567; Interrogation_Position=759; Antisense; GGCAGCTGCTCCATTATTACCAAAA

Paste this into a BLAST search page for me
CATCGAATCGGTCTGCTTCTGGTTCTGCTTTGTCCGCGTGAATGTCAGTGTGATCATCGAATCGCCGAGGTGCTGATCTGCGAACTGGACTTTGGCTACAGATTGCGCTACGATGACCTGGAGATAACGATGTCTCTAACCTGAACTTCAACTGTGGCGCGATAACTGTGTTAACAAGGTCGAACTGTACAACGCACTGCAACGCACTGCAGTTGGAGGCCAAGCGAAAATCGGCATCATGGAGCGGCATGCATGGCGTTGTTTATCCCTGGCAATGGCAATTGAATCATTCGCTCCCGTGTTCGTTTCGCAATCGCCAACTGAAGGCAGCTGCTCCATTATTACCAAAA

Full Affymetrix probeset data:

Annotations for 1637447_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime