Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637448_s_at:

>probe:Drosophila_2:1637448_s_at:287:69; Interrogation_Position=108; Antisense; AGGCGGTCGCCGTCTTCTTGAAGAA
>probe:Drosophila_2:1637448_s_at:222:373; Interrogation_Position=145; Antisense; GAAGGTGCCCGACCAGATGGACATC
>probe:Drosophila_2:1637448_s_at:245:441; Interrogation_Position=160; Antisense; GATGGACATCGTCAAGACCGCCAAA
>probe:Drosophila_2:1637448_s_at:362:45; Interrogation_Position=207; Antisense; ATCCCGACTGGTTCTATGTGCGTTG
>probe:Drosophila_2:1637448_s_at:727:329; Interrogation_Position=269; Antisense; GCTGGAGTCGGTTCGATCACCAAGA
>probe:Drosophila_2:1637448_s_at:239:97; Interrogation_Position=291; Antisense; AGATCTACGGCGGACGCAAGCGCAA
>probe:Drosophila_2:1637448_s_at:564:111; Interrogation_Position=384; Antisense; AGCACGCCCGTTTGGTCGAGAAGCA
>probe:Drosophila_2:1637448_s_at:508:729; Interrogation_Position=438; Antisense; TTGGACAGCGTGATCTGGACCGTAT
>probe:Drosophila_2:1637448_s_at:601:549; Interrogation_Position=454; Antisense; GGACCGTATTGCTAACCAGATCGTG
>probe:Drosophila_2:1637448_s_at:409:129; Interrogation_Position=468; Antisense; ACCAGATCGTGTTCAAGCAGCGCGA
>probe:Drosophila_2:1637448_s_at:727:411; Interrogation_Position=505; Antisense; GACCGGGCCCATTGTTATTTCCAAG
>probe:Drosophila_2:1637448_s_at:284:685; Interrogation_Position=520; Antisense; TATTTCCAAGTAATCACACGGCGCC
>probe:Drosophila_2:1637448_s_at:386:493; Interrogation_Position=583; Antisense; GTAAGCGCTTTTTGTTTGCACGAGA
>probe:Drosophila_2:1637448_s_at:627:459; Interrogation_Position=83; Antisense; GATATTGACCAGCACGCGGTTACCA

Paste this into a BLAST search page for me
AGGCGGTCGCCGTCTTCTTGAAGAAGAAGGTGCCCGACCAGATGGACATCGATGGACATCGTCAAGACCGCCAAAATCCCGACTGGTTCTATGTGCGTTGGCTGGAGTCGGTTCGATCACCAAGAAGATCTACGGCGGACGCAAGCGCAAAGCACGCCCGTTTGGTCGAGAAGCATTGGACAGCGTGATCTGGACCGTATGGACCGTATTGCTAACCAGATCGTGACCAGATCGTGTTCAAGCAGCGCGAGACCGGGCCCATTGTTATTTCCAAGTATTTCCAAGTAATCACACGGCGCCGTAAGCGCTTTTTGTTTGCACGAGAGATATTGACCAGCACGCGGTTACCA

Full Affymetrix probeset data:

Annotations for 1637448_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime