Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637453_at:

>probe:Drosophila_2:1637453_at:660:299; Interrogation_Position=2189; Antisense; CGCCCTTGCAGTTGTACGTGAATCA
>probe:Drosophila_2:1637453_at:283:353; Interrogation_Position=2214; Antisense; GCAGCGGATATACTCAAGCGATCGA
>probe:Drosophila_2:1637453_at:307:381; Interrogation_Position=2260; Antisense; GAACGCAGGTTCTCATAATGATATA
>probe:Drosophila_2:1637453_at:18:15; Interrogation_Position=2301; Antisense; ATTACTAAACTTACGGTGGATCACA
>probe:Drosophila_2:1637453_at:353:169; Interrogation_Position=2329; Antisense; AAAGGATGCTCGTCTCGGTTTCACA
>probe:Drosophila_2:1637453_at:13:541; Interrogation_Position=2345; Antisense; GGTTTCACATCCTCATGTTAGGACT
>probe:Drosophila_2:1637453_at:316:213; Interrogation_Position=2381; Antisense; AAGATCGTCTAACAAGCCAGCCGGA
>probe:Drosophila_2:1637453_at:347:449; Interrogation_Position=2482; Antisense; GATCCATTAAAGTTGCACAGTTGCC
>probe:Drosophila_2:1637453_at:151:93; Interrogation_Position=2500; Antisense; AGTTGCCAACTATAATGCCCTCGAT
>probe:Drosophila_2:1637453_at:104:235; Interrogation_Position=2513; Antisense; AATGCCCTCGATTGTCCACCGAGTA
>probe:Drosophila_2:1637453_at:136:133; Interrogation_Position=2530; Antisense; ACCGAGTACATTCCGCATCTATAAT
>probe:Drosophila_2:1637453_at:251:633; Interrogation_Position=2541; Antisense; TCCGCATCTATAATCCGTGTCACAA
>probe:Drosophila_2:1637453_at:179:305; Interrogation_Position=2555; Antisense; CCGTGTCACAAAATCGATCCACCAT
>probe:Drosophila_2:1637453_at:645:447; Interrogation_Position=2570; Antisense; GATCCACCATGCCTATATAAACCTA

Paste this into a BLAST search page for me
CGCCCTTGCAGTTGTACGTGAATCAGCAGCGGATATACTCAAGCGATCGAGAACGCAGGTTCTCATAATGATATAATTACTAAACTTACGGTGGATCACAAAAGGATGCTCGTCTCGGTTTCACAGGTTTCACATCCTCATGTTAGGACTAAGATCGTCTAACAAGCCAGCCGGAGATCCATTAAAGTTGCACAGTTGCCAGTTGCCAACTATAATGCCCTCGATAATGCCCTCGATTGTCCACCGAGTAACCGAGTACATTCCGCATCTATAATTCCGCATCTATAATCCGTGTCACAACCGTGTCACAAAATCGATCCACCATGATCCACCATGCCTATATAAACCTA

Full Affymetrix probeset data:

Annotations for 1637453_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime