Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637454_a_at:

>probe:Drosophila_2:1637454_a_at:702:625; Interrogation_Position=144; Antisense; TGCCGGAAAGCTGATGCGCGACGTC
>probe:Drosophila_2:1637454_a_at:228:317; Interrogation_Position=174; Antisense; GCCCAAGTATCCGAAGGTCAGCGTC
>probe:Drosophila_2:1637454_a_at:394:435; Interrogation_Position=199; Antisense; GAGGTGGCCGACAACATTCGCAACG
>probe:Drosophila_2:1637454_a_at:194:587; Interrogation_Position=20; Antisense; TGGAGTCTGGAATCCGCCAAATCGT
>probe:Drosophila_2:1637454_a_at:338:713; Interrogation_Position=215; Antisense; TTCGCAACGGTGACATACCCAATAG
>probe:Drosophila_2:1637454_a_at:371:251; Interrogation_Position=240; Antisense; CAAGGACACCAACTGCTACATCAAT
>probe:Drosophila_2:1637454_a_at:150:341; Interrogation_Position=254; Antisense; GCTACATCAATTGCATCCTGGAAAT
>probe:Drosophila_2:1637454_a_at:704:431; Interrogation_Position=313; Antisense; GAGTCGACCCTCAAGCAGATGGACA
>probe:Drosophila_2:1637454_a_at:619:99; Interrogation_Position=329; Antisense; AGATGGACATCATGCTGCCGGACAG
>probe:Drosophila_2:1637454_a_at:148:283; Interrogation_Position=343; Antisense; CTGCCGGACAGCTACAAGGACGAGT
>probe:Drosophila_2:1637454_a_at:282:555; Interrogation_Position=360; Antisense; GGACGAGTACCGCAAGGGCATCAAT
>probe:Drosophila_2:1637454_a_at:542:33; Interrogation_Position=379; Antisense; ATCAATCTGTGCAAGGACTCCACCG
>probe:Drosophila_2:1637454_a_at:516:149; Interrogation_Position=467; Antisense; ACATCAAGGTATTCGTGTTTCCCTA
>probe:Drosophila_2:1637454_a_at:86:233; Interrogation_Position=51; Antisense; AATGAAGTTCCATCTGCTGCTGGTC

Paste this into a BLAST search page for me
TGCCGGAAAGCTGATGCGCGACGTCGCCCAAGTATCCGAAGGTCAGCGTCGAGGTGGCCGACAACATTCGCAACGTGGAGTCTGGAATCCGCCAAATCGTTTCGCAACGGTGACATACCCAATAGCAAGGACACCAACTGCTACATCAATGCTACATCAATTGCATCCTGGAAATGAGTCGACCCTCAAGCAGATGGACAAGATGGACATCATGCTGCCGGACAGCTGCCGGACAGCTACAAGGACGAGTGGACGAGTACCGCAAGGGCATCAATATCAATCTGTGCAAGGACTCCACCGACATCAAGGTATTCGTGTTTCCCTAAATGAAGTTCCATCTGCTGCTGGTC

Full Affymetrix probeset data:

Annotations for 1637454_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime