FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637455_at:

>probe:Drosophila_2:1637455_at:215:161; Interrogation_Position=370; Antisense; ACAAGTGGCGGCTATGCGGAGCACA
>probe:Drosophila_2:1637455_at:70:553; Interrogation_Position=387; Antisense; GGAGCACAAGCTGCAGCTGAGCAAA
>probe:Drosophila_2:1637455_at:336:209; Interrogation_Position=408; Antisense; CAAAAGTGGCCGGAAGCCGCGACGC
>probe:Drosophila_2:1637455_at:529:263; Interrogation_Position=457; Antisense; CAGCTCGCCTACTTGGAGCGGAAGT
>probe:Drosophila_2:1637455_at:141:329; Interrogation_Position=474; Antisense; GCGGAAGTTCCGGTGCCAGAAGTAC
>probe:Drosophila_2:1637455_at:555:109; Interrogation_Position=491; Antisense; AGAAGTACCTGAGCGTGGCCGATCG
>probe:Drosophila_2:1637455_at:560:441; Interrogation_Position=520; Antisense; GATGTGGCCGAAACGCTCAATCTGT
>probe:Drosophila_2:1637455_at:262:563; Interrogation_Position=590; Antisense; GGAAGCGACAGAATCAACTGCGTCT
>probe:Drosophila_2:1637455_at:548:119; Interrogation_Position=620; Antisense; AGCTGCGTCATCAGGCGACCATGGA
>probe:Drosophila_2:1637455_at:108:599; Interrogation_Position=694; Antisense; TGTCCCAGCGGACTGAGCAGTTCTT
>probe:Drosophila_2:1637455_at:299:609; Interrogation_Position=707; Antisense; TGAGCAGTTCTTTTAGTGCCGCCGC
>probe:Drosophila_2:1637455_at:495:111; Interrogation_Position=751; Antisense; AGCAATCCTTGCAATTTTCTCACTT
>probe:Drosophila_2:1637455_at:265:577; Interrogation_Position=789; Antisense; GGCCATTTTCCGTAATGTCGGCTAT
>probe:Drosophila_2:1637455_at:575:229; Interrogation_Position=802; Antisense; AATGTCGGCTATGTCCACGGATGTC

Paste this into a BLAST search page for me
ACAAGTGGCGGCTATGCGGAGCACAGGAGCACAAGCTGCAGCTGAGCAAACAAAAGTGGCCGGAAGCCGCGACGCCAGCTCGCCTACTTGGAGCGGAAGTGCGGAAGTTCCGGTGCCAGAAGTACAGAAGTACCTGAGCGTGGCCGATCGGATGTGGCCGAAACGCTCAATCTGTGGAAGCGACAGAATCAACTGCGTCTAGCTGCGTCATCAGGCGACCATGGATGTCCCAGCGGACTGAGCAGTTCTTTGAGCAGTTCTTTTAGTGCCGCCGCAGCAATCCTTGCAATTTTCTCACTTGGCCATTTTCCGTAATGTCGGCTATAATGTCGGCTATGTCCACGGATGTC

Full Affymetrix probeset data:

Annotations for 1637455_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720