FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637456_at:

>probe:Drosophila_2:1637456_at:133:561; Interrogation_Position=3473; Antisense; GGAACGAACAGGACAGATCCTACTT
>probe:Drosophila_2:1637456_at:592:29; Interrogation_Position=3498; Antisense; ATAATCATACTTCGGACCTGTCGGC
>probe:Drosophila_2:1637456_at:206:349; Interrogation_Position=3521; Antisense; GCAGGCGAGGCATGGACACGAACTA
>probe:Drosophila_2:1637456_at:638:147; Interrogation_Position=3542; Antisense; ACTAGTGAGACCGACAACATGTTGT
>probe:Drosophila_2:1637456_at:478:79; Interrogation_Position=3608; Antisense; AGGTTTTTTGATTGGCACTCTCAGC
>probe:Drosophila_2:1637456_at:270:567; Interrogation_Position=3621; Antisense; GGCACTCTCAGCTCCATAGGGAAGA
>probe:Drosophila_2:1637456_at:451:673; Interrogation_Position=3666; Antisense; TACCATGTACGAGTAGTCCCCAGAT
>probe:Drosophila_2:1637456_at:309:485; Interrogation_Position=3678; Antisense; GTAGTCCCCAGATGTAAGAGATGTT
>probe:Drosophila_2:1637456_at:159:81; Interrogation_Position=3715; Antisense; AGGTGCACAGGAGCAGTGCGCCATT
>probe:Drosophila_2:1637456_at:128:625; Interrogation_Position=3731; Antisense; TGCGCCATTGGCCTTGATAGGAAAT
>probe:Drosophila_2:1637456_at:590:479; Interrogation_Position=3800; Antisense; GTTTCGTTAGGCTATCAACAACCAT
>probe:Drosophila_2:1637456_at:376:25; Interrogation_Position=3828; Antisense; ATAGACCACATGTACGACTCGTTTC
>probe:Drosophila_2:1637456_at:573:309; Interrogation_Position=3855; Antisense; CCACATTTCATGCAGCCAGGTACAT
>probe:Drosophila_2:1637456_at:52:315; Interrogation_Position=3869; Antisense; GCCAGGTACATACTCTCCTCAAAAA

Paste this into a BLAST search page for me
GGAACGAACAGGACAGATCCTACTTATAATCATACTTCGGACCTGTCGGCGCAGGCGAGGCATGGACACGAACTAACTAGTGAGACCGACAACATGTTGTAGGTTTTTTGATTGGCACTCTCAGCGGCACTCTCAGCTCCATAGGGAAGATACCATGTACGAGTAGTCCCCAGATGTAGTCCCCAGATGTAAGAGATGTTAGGTGCACAGGAGCAGTGCGCCATTTGCGCCATTGGCCTTGATAGGAAATGTTTCGTTAGGCTATCAACAACCATATAGACCACATGTACGACTCGTTTCCCACATTTCATGCAGCCAGGTACATGCCAGGTACATACTCTCCTCAAAAA

Full Affymetrix probeset data:

Annotations for 1637456_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720