FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637457_at:

>probe:Drosophila_2:1637457_at:84:531; Interrogation_Position=114; Antisense; GGGATTTAAGCAAGATTGCCCCAAC
>probe:Drosophila_2:1637457_at:65:217; Interrogation_Position=125; Antisense; AAGATTGCCCCAACGGCCGATTGAC
>probe:Drosophila_2:1637457_at:343:195; Interrogation_Position=136; Antisense; AACGGCCGATTGACGCCAGCTAAGT
>probe:Drosophila_2:1637457_at:690:317; Interrogation_Position=140; Antisense; GCCGATTGACGCCAGCTAAGTTTGT
>probe:Drosophila_2:1637457_at:2:301; Interrogation_Position=149; Antisense; CGCCAGCTAAGTTTGTCGATATGTA
>probe:Drosophila_2:1637457_at:658:261; Interrogation_Position=152; Antisense; CAGCTAAGTTTGTCGATATGTATAA
>probe:Drosophila_2:1637457_at:150:475; Interrogation_Position=171; Antisense; GTATAAAATGTTCTTTCCATCCGGA
>probe:Drosophila_2:1637457_at:657:601; Interrogation_Position=179; Antisense; TGTTCTTTCCATCCGGAAATGCGGA
>probe:Drosophila_2:1637457_at:293:395; Interrogation_Position=194; Antisense; GAAATGCGGAAGAGTTTTGTGACCA
>probe:Drosophila_2:1637457_at:387:429; Interrogation_Position=205; Antisense; GAGTTTTGTGACCATGTTTTTCGTA
>probe:Drosophila_2:1637457_at:568:511; Interrogation_Position=212; Antisense; GTGACCATGTTTTTCGTACATTCGA
>probe:Drosophila_2:1637457_at:352:477; Interrogation_Position=220; Antisense; GTTTTTCGTACATTCGATATGGACA
>probe:Drosophila_2:1637457_at:25:639; Interrogation_Position=225; Antisense; TCGTACATTCGATATGGACAAAAAT
>probe:Drosophila_2:1637457_at:158:599; Interrogation_Position=258; Antisense; TGACTTTAAGGAATTTTTACTCGCA

Paste this into a BLAST search page for me
GGGATTTAAGCAAGATTGCCCCAACAAGATTGCCCCAACGGCCGATTGACAACGGCCGATTGACGCCAGCTAAGTGCCGATTGACGCCAGCTAAGTTTGTCGCCAGCTAAGTTTGTCGATATGTACAGCTAAGTTTGTCGATATGTATAAGTATAAAATGTTCTTTCCATCCGGATGTTCTTTCCATCCGGAAATGCGGAGAAATGCGGAAGAGTTTTGTGACCAGAGTTTTGTGACCATGTTTTTCGTAGTGACCATGTTTTTCGTACATTCGAGTTTTTCGTACATTCGATATGGACATCGTACATTCGATATGGACAAAAATTGACTTTAAGGAATTTTTACTCGCA

Full Affymetrix probeset data:

Annotations for 1637457_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720