FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637460_at:

>probe:Drosophila_2:1637460_at:642:589; Interrogation_Position=1011; Antisense; TGGTTCTAAGCGCTTCTGCATCTGC
>probe:Drosophila_2:1637460_at:138:231; Interrogation_Position=1069; Antisense; AATGTCGCCGCGTGAAATGCGCGAG
>probe:Drosophila_2:1637460_at:191:461; Interrogation_Position=1105; Antisense; GATTAAGCACAGTTTCCGTGCCCAA
>probe:Drosophila_2:1637460_at:147:197; Interrogation_Position=1128; Antisense; AACTGGAAGCAGAGCCCTCCGTATC
>probe:Drosophila_2:1637460_at:180:311; Interrogation_Position=1184; Antisense; GCCAACCATGGCAAGGGACGAGCTC
>probe:Drosophila_2:1637460_at:318:313; Interrogation_Position=1222; Antisense; GCCACCCAAGAAGCACTCATTGAGT
>probe:Drosophila_2:1637460_at:255:411; Interrogation_Position=1256; Antisense; GACGCCATCAGCCAGACATCGACGG
>probe:Drosophila_2:1637460_at:509:151; Interrogation_Position=1271; Antisense; ACATCGACGGGCAGCGTGGAACGCA
>probe:Drosophila_2:1637460_at:271:89; Interrogation_Position=1296; Antisense; AGTCAGGTATCGGACAACTGTTCAA
>probe:Drosophila_2:1637460_at:41:663; Interrogation_Position=1345; Antisense; TAACAAAGCTAATCCCAGCCAGCAG
>probe:Drosophila_2:1637460_at:157:333; Interrogation_Position=1387; Antisense; GCTGGCGGCCAAAGAGACACAGATT
>probe:Drosophila_2:1637460_at:526:145; Interrogation_Position=923; Antisense; ACTCCGAATGGATCTGCTGAAACTA
>probe:Drosophila_2:1637460_at:78:143; Interrogation_Position=947; Antisense; ACTGATTCAGGAACACCTTCCCAAA
>probe:Drosophila_2:1637460_at:2:457; Interrogation_Position=994; Antisense; GATAGACCCATTTTTGCTGGTTCTA

Paste this into a BLAST search page for me
TGGTTCTAAGCGCTTCTGCATCTGCAATGTCGCCGCGTGAAATGCGCGAGGATTAAGCACAGTTTCCGTGCCCAAAACTGGAAGCAGAGCCCTCCGTATCGCCAACCATGGCAAGGGACGAGCTCGCCACCCAAGAAGCACTCATTGAGTGACGCCATCAGCCAGACATCGACGGACATCGACGGGCAGCGTGGAACGCAAGTCAGGTATCGGACAACTGTTCAATAACAAAGCTAATCCCAGCCAGCAGGCTGGCGGCCAAAGAGACACAGATTACTCCGAATGGATCTGCTGAAACTAACTGATTCAGGAACACCTTCCCAAAGATAGACCCATTTTTGCTGGTTCTA

Full Affymetrix probeset data:

Annotations for 1637460_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720