Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637461_at:

>probe:Drosophila_2:1637461_at:329:409; Interrogation_Position=1559; Antisense; GAGCGAACTCCTGCCGAAGTTTTGG
>probe:Drosophila_2:1637461_at:411:371; Interrogation_Position=1574; Antisense; GAAGTTTTGGATCCGCTCAATCTAC
>probe:Drosophila_2:1637461_at:43:655; Interrogation_Position=1590; Antisense; TCAATCTACTTAATGCCCTCAACTG
>probe:Drosophila_2:1637461_at:693:581; Interrogation_Position=1613; Antisense; TGGCTTACCGTCTGGCAACTGGATA
>probe:Drosophila_2:1637461_at:677:73; Interrogation_Position=1694; Antisense; AGGAACAACATCCAGGTCTTTGCCG
>probe:Drosophila_2:1637461_at:268:109; Interrogation_Position=1722; Antisense; AGAAGCTCTCCATTATCTACGGCGA
>probe:Drosophila_2:1637461_at:289:729; Interrogation_Position=1772; Antisense; TTGGTCACAAAGTACTCCGCTGCTT
>probe:Drosophila_2:1637461_at:409:671; Interrogation_Position=1844; Antisense; TACGAACAGGGCATTCTGGCTCTGC
>probe:Drosophila_2:1637461_at:574:379; Interrogation_Position=1886; Antisense; GAAGCCATTGCTCTGGTGGATGCCA
>probe:Drosophila_2:1637461_at:454:699; Interrogation_Position=1925; Antisense; TTTATTCTAAACTCTCCTCTGGGCA
>probe:Drosophila_2:1637461_at:555:585; Interrogation_Position=1957; Antisense; TGGAAACGTCTACCAGCATCTGCAG
>probe:Drosophila_2:1637461_at:355:137; Interrogation_Position=2010; Antisense; ACGAGCGTCCTCATTGGTGGCGTGA
>probe:Drosophila_2:1637461_at:552:251; Interrogation_Position=2044; Antisense; CAAGGATTACCTTAAGCGCGCCAAA
>probe:Drosophila_2:1637461_at:451:323; Interrogation_Position=2059; Antisense; GCGCGCCAAATTGTAGACTCACTGT

Paste this into a BLAST search page for me
GAGCGAACTCCTGCCGAAGTTTTGGGAAGTTTTGGATCCGCTCAATCTACTCAATCTACTTAATGCCCTCAACTGTGGCTTACCGTCTGGCAACTGGATAAGGAACAACATCCAGGTCTTTGCCGAGAAGCTCTCCATTATCTACGGCGATTGGTCACAAAGTACTCCGCTGCTTTACGAACAGGGCATTCTGGCTCTGCGAAGCCATTGCTCTGGTGGATGCCATTTATTCTAAACTCTCCTCTGGGCATGGAAACGTCTACCAGCATCTGCAGACGAGCGTCCTCATTGGTGGCGTGACAAGGATTACCTTAAGCGCGCCAAAGCGCGCCAAATTGTAGACTCACTGT

Full Affymetrix probeset data:

Annotations for 1637461_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime