FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637462_at:

>probe:Drosophila_2:1637462_at:470:507; Interrogation_Position=390; Antisense; GGAAATGGGTCCAGTTACCGTCCTG
>probe:Drosophila_2:1637462_at:286:333; Interrogation_Position=424; Antisense; GCTGGTGTCATGATGCATCGCAATA
>probe:Drosophila_2:1637462_at:183:363; Interrogation_Position=443; Antisense; GCAATATGTTTAATCCGGACCCGGC
>probe:Drosophila_2:1637462_at:159:471; Interrogation_Position=490; Antisense; GTTAACCTTACGTCGCATTTCTGGA
>probe:Drosophila_2:1637462_at:519:253; Interrogation_Position=516; Antisense; CAAGCTGGTTTTCCTACCCAAAATG
>probe:Drosophila_2:1637462_at:192:473; Interrogation_Position=575; Antisense; GTTCATTGGCAGGTGTTTTCCCATT
>probe:Drosophila_2:1637462_at:300:75; Interrogation_Position=652; Antisense; AGGACCCTGCGCATGGAGTTGGATC
>probe:Drosophila_2:1637462_at:621:263; Interrogation_Position=717; Antisense; CAGTTTTCTGCGCACGAACAGTGAT
>probe:Drosophila_2:1637462_at:366:353; Interrogation_Position=747; Antisense; GCAGCTGACGCATACCATAGGATTT
>probe:Drosophila_2:1637462_at:659:481; Interrogation_Position=778; Antisense; GTATATCCACTGTTCACCGGAGAGG
>probe:Drosophila_2:1637462_at:710:501; Interrogation_Position=805; Antisense; GTCGCCCAGCGTATAGTGGCCGGAA
>probe:Drosophila_2:1637462_at:11:371; Interrogation_Position=863; Antisense; GAATGGCATGCCTACTCTACCGAGT
>probe:Drosophila_2:1637462_at:305:671; Interrogation_Position=880; Antisense; TACCGAGTGATTCTCATACTTCCGG
>probe:Drosophila_2:1637462_at:378:29; Interrogation_Position=895; Antisense; ATACTTCCGGCTGACTGGCAAGATC

Paste this into a BLAST search page for me
GGAAATGGGTCCAGTTACCGTCCTGGCTGGTGTCATGATGCATCGCAATAGCAATATGTTTAATCCGGACCCGGCGTTAACCTTACGTCGCATTTCTGGACAAGCTGGTTTTCCTACCCAAAATGGTTCATTGGCAGGTGTTTTCCCATTAGGACCCTGCGCATGGAGTTGGATCCAGTTTTCTGCGCACGAACAGTGATGCAGCTGACGCATACCATAGGATTTGTATATCCACTGTTCACCGGAGAGGGTCGCCCAGCGTATAGTGGCCGGAAGAATGGCATGCCTACTCTACCGAGTTACCGAGTGATTCTCATACTTCCGGATACTTCCGGCTGACTGGCAAGATC

Full Affymetrix probeset data:

Annotations for 1637462_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720