FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637465_at:

>probe:Drosophila_2:1637465_at:392:343; Interrogation_Position=489; Antisense; GCTTCACTTCTTCGTGACGGGCATA
>probe:Drosophila_2:1637465_at:557:611; Interrogation_Position=503; Antisense; TGACGGGCATAACACCAGCGGCAAT
>probe:Drosophila_2:1637465_at:298:39; Interrogation_Position=553; Antisense; ATCGGTTTGGTACATTCACCCATGG
>probe:Drosophila_2:1637465_at:204:405; Interrogation_Position=582; Antisense; GACTCTTCTGTTCATGATATCCTCG
>probe:Drosophila_2:1637465_at:699:47; Interrogation_Position=600; Antisense; ATCCTCGGTGATAGTCTTGCATTAC
>probe:Drosophila_2:1637465_at:638:257; Interrogation_Position=625; Antisense; CAGCAGACTCGAAAGTACTCCGGTT
>probe:Drosophila_2:1637465_at:219:635; Interrogation_Position=640; Antisense; TACTCCGGTTTCTGGTTCATTCGAC
>probe:Drosophila_2:1637465_at:43:715; Interrogation_Position=669; Antisense; TTCTCTGCCCGAGGATACCGAAGAT
>probe:Drosophila_2:1637465_at:166:427; Interrogation_Position=735; Antisense; GAGATCATACTTGGGCATTGGACTG
>probe:Drosophila_2:1637465_at:695:585; Interrogation_Position=753; Antisense; TGGACTGGCAATGGATCTGCTCAAT
>probe:Drosophila_2:1637465_at:524:451; Interrogation_Position=766; Antisense; GATCTGCTCAATCCCTTGATGAAGC
>probe:Drosophila_2:1637465_at:30:391; Interrogation_Position=791; Antisense; GAAACATGAAACTCTGGCGACCCAA
>probe:Drosophila_2:1637465_at:699:393; Interrogation_Position=819; Antisense; GACAAGTTTCTTGGCGGGCTACATA
>probe:Drosophila_2:1637465_at:312:25; Interrogation_Position=878; Antisense; ATAGGTCTTCCCAGTGTCAATGCGA

Paste this into a BLAST search page for me
GCTTCACTTCTTCGTGACGGGCATATGACGGGCATAACACCAGCGGCAATATCGGTTTGGTACATTCACCCATGGGACTCTTCTGTTCATGATATCCTCGATCCTCGGTGATAGTCTTGCATTACCAGCAGACTCGAAAGTACTCCGGTTTACTCCGGTTTCTGGTTCATTCGACTTCTCTGCCCGAGGATACCGAAGATGAGATCATACTTGGGCATTGGACTGTGGACTGGCAATGGATCTGCTCAATGATCTGCTCAATCCCTTGATGAAGCGAAACATGAAACTCTGGCGACCCAAGACAAGTTTCTTGGCGGGCTACATAATAGGTCTTCCCAGTGTCAATGCGA

Full Affymetrix probeset data:

Annotations for 1637465_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720