FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637467_at:

>probe:Drosophila_2:1637467_at:519:623; Interrogation_Position=1012; Antisense; TGCGCCGAATGCTCGAAATCTTTCT
>probe:Drosophila_2:1637467_at:30:423; Interrogation_Position=1079; Antisense; GAGAGCGGCCCTTTAAGTGTACCCA
>probe:Drosophila_2:1637467_at:540:487; Interrogation_Position=1097; Antisense; GTACCCACTGTTTCAAGGACTTCAA
>probe:Drosophila_2:1637467_at:74:165; Interrogation_Position=1120; Antisense; AAATGTCGTACGCATCTTCGGGTGC
>probe:Drosophila_2:1637467_at:631:53; Interrogation_Position=1168; Antisense; AAGGTACCCAAGTGTTCCTACTGCT
>probe:Drosophila_2:1637467_at:276:193; Interrogation_Position=1205; Antisense; AACTAAGCTCGCAACTGCTGGTGCA
>probe:Drosophila_2:1637467_at:378:173; Interrogation_Position=1250; Antisense; AAAACCAATTCGAGTGTCCCCACTG
>probe:Drosophila_2:1637467_at:319:673; Interrogation_Position=1293; Antisense; TAGCTCGACTCTTCACATGCATTTG
>probe:Drosophila_2:1637467_at:472:551; Interrogation_Position=1330; Antisense; GGAGAATTGCCCTTCAAGTGTTCGC
>probe:Drosophila_2:1637467_at:463:603; Interrogation_Position=1348; Antisense; TGTTCGCACTGCTCAAAATTGTTTG
>probe:Drosophila_2:1637467_at:129:385; Interrogation_Position=1384; Antisense; GAACACCAGGAACACTTGCGAACGC
>probe:Drosophila_2:1637467_at:133:183; Interrogation_Position=1460; Antisense; AAAAGTCCAGTCTTGGGCGACACCT
>probe:Drosophila_2:1637467_at:298:607; Interrogation_Position=956; Antisense; TGAGGTCACTTTATCGAGTCCACGT
>probe:Drosophila_2:1637467_at:124:433; Interrogation_Position=971; Antisense; GAGTCCACGTGCGTTTGCATACAAG

Paste this into a BLAST search page for me
TGCGCCGAATGCTCGAAATCTTTCTGAGAGCGGCCCTTTAAGTGTACCCAGTACCCACTGTTTCAAGGACTTCAAAAATGTCGTACGCATCTTCGGGTGCAAGGTACCCAAGTGTTCCTACTGCTAACTAAGCTCGCAACTGCTGGTGCAAAAACCAATTCGAGTGTCCCCACTGTAGCTCGACTCTTCACATGCATTTGGGAGAATTGCCCTTCAAGTGTTCGCTGTTCGCACTGCTCAAAATTGTTTGGAACACCAGGAACACTTGCGAACGCAAAAGTCCAGTCTTGGGCGACACCTTGAGGTCACTTTATCGAGTCCACGTGAGTCCACGTGCGTTTGCATACAAG

Full Affymetrix probeset data:

Annotations for 1637467_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720