FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637468_at:

>probe:Drosophila_2:1637468_at:294:445; Interrogation_Position=1761; Antisense; GATGACAGCGGAGATGAGGCCTCAT
>probe:Drosophila_2:1637468_at:571:439; Interrogation_Position=1776; Antisense; GAGGCCTCATCTGACGATGATGACC
>probe:Drosophila_2:1637468_at:38:99; Interrogation_Position=1877; Antisense; AGATGACGAGCAGCAGCCGGATGAA
>probe:Drosophila_2:1637468_at:265:413; Interrogation_Position=1921; Antisense; GACCGCAGACGAATGGACACAGCCA
>probe:Drosophila_2:1637468_at:113:227; Interrogation_Position=1959; Antisense; AATGGCAACCGTTTCACCATGACCC
>probe:Drosophila_2:1637468_at:433:589; Interrogation_Position=1987; Antisense; TGGATCAACATCAAGGCAGCAGTCT
>probe:Drosophila_2:1637468_at:437:171; Interrogation_Position=2031; Antisense; AAAGCGAGCTTGCAGGATCGCGTAA
>probe:Drosophila_2:1637468_at:130:451; Interrogation_Position=2046; Antisense; GATCGCGTAAGGGTCATGTCCCAGC
>probe:Drosophila_2:1637468_at:53:63; Interrogation_Position=2061; Antisense; ATGTCCCAGCTGGAGGGCCAGGTCA
>probe:Drosophila_2:1637468_at:458:79; Interrogation_Position=2080; Antisense; AGGTCACCAATGTGGGTCGCTCCCT
>probe:Drosophila_2:1637468_at:348:633; Interrogation_Position=2100; Antisense; TCCCTGGGCAATCGTCAGATGACAT
>probe:Drosophila_2:1637468_at:674:109; Interrogation_Position=2143; Antisense; AGAAGTCACAGTTCCATGCCAAGAA
>probe:Drosophila_2:1637468_at:53:325; Interrogation_Position=2201; Antisense; GCGAAGGAGCATTGTCAGACCCATT
>probe:Drosophila_2:1637468_at:547:103; Interrogation_Position=2217; Antisense; AGACCCATTAAGTCGCTGAGACTAA

Paste this into a BLAST search page for me
GATGACAGCGGAGATGAGGCCTCATGAGGCCTCATCTGACGATGATGACCAGATGACGAGCAGCAGCCGGATGAAGACCGCAGACGAATGGACACAGCCAAATGGCAACCGTTTCACCATGACCCTGGATCAACATCAAGGCAGCAGTCTAAAGCGAGCTTGCAGGATCGCGTAAGATCGCGTAAGGGTCATGTCCCAGCATGTCCCAGCTGGAGGGCCAGGTCAAGGTCACCAATGTGGGTCGCTCCCTTCCCTGGGCAATCGTCAGATGACATAGAAGTCACAGTTCCATGCCAAGAAGCGAAGGAGCATTGTCAGACCCATTAGACCCATTAAGTCGCTGAGACTAA

Full Affymetrix probeset data:

Annotations for 1637468_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720