FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637469_at:

>probe:Drosophila_2:1637469_at:702:167; Interrogation_Position=119; Antisense; AAAGGCACCAAATCCGCGAAAACTG
>probe:Drosophila_2:1637469_at:3:553; Interrogation_Position=143; Antisense; GGAGCTGTGTCGCAAATACTTCTTT
>probe:Drosophila_2:1637469_at:509:241; Interrogation_Position=157; Antisense; AATACTTCTTTGCTGGCTTTGCATT
>probe:Drosophila_2:1637469_at:643:341; Interrogation_Position=172; Antisense; GCTTTGCATTTCTGCCCTTTGTGTG
>probe:Drosophila_2:1637469_at:98:727; Interrogation_Position=190; Antisense; TTGTGTGGGCCATTAACGTTTGCTG
>probe:Drosophila_2:1637469_at:18:693; Interrogation_Position=208; Antisense; TTTGCTGGTTTTTCACGGAGGCCTT
>probe:Drosophila_2:1637469_at:451:659; Interrogation_Position=236; Antisense; TAAGCCACCATTTTCGGAGCAGAGC
>probe:Drosophila_2:1637469_at:452:527; Interrogation_Position=291; Antisense; GGGACTCTATTCTGGCTGATAGTAC
>probe:Drosophila_2:1637469_at:635:333; Interrogation_Position=305; Antisense; GCTGATAGTACTAACTGCCTGGATA
>probe:Drosophila_2:1637469_at:114:323; Interrogation_Position=361; Antisense; GCGCCACAGCGGACTATATGAGCTT
>probe:Drosophila_2:1637469_at:129:25; Interrogation_Position=376; Antisense; ATATGAGCTTCATCATACCCCTAGG
>probe:Drosophila_2:1637469_at:388:37; Interrogation_Position=387; Antisense; ATCATACCCCTAGGCAGTGCATAGA
>probe:Drosophila_2:1637469_at:620:717; Interrogation_Position=42; Antisense; TTCCTGGGCCGGAAACAGATTCGAA
>probe:Drosophila_2:1637469_at:656:551; Interrogation_Position=73; Antisense; GGAGCAAACACCCACATATTTGAAG

Paste this into a BLAST search page for me
AAAGGCACCAAATCCGCGAAAACTGGGAGCTGTGTCGCAAATACTTCTTTAATACTTCTTTGCTGGCTTTGCATTGCTTTGCATTTCTGCCCTTTGTGTGTTGTGTGGGCCATTAACGTTTGCTGTTTGCTGGTTTTTCACGGAGGCCTTTAAGCCACCATTTTCGGAGCAGAGCGGGACTCTATTCTGGCTGATAGTACGCTGATAGTACTAACTGCCTGGATAGCGCCACAGCGGACTATATGAGCTTATATGAGCTTCATCATACCCCTAGGATCATACCCCTAGGCAGTGCATAGATTCCTGGGCCGGAAACAGATTCGAAGGAGCAAACACCCACATATTTGAAG

Full Affymetrix probeset data:

Annotations for 1637469_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720