FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1637470_at:

>probe:Drosophila_2:1637470_at:624:663; Interrogation_Position=1772; Antisense; TAAAGCCGAACTCCCCATAGCCAGA
>probe:Drosophila_2:1637470_at:204:273; Interrogation_Position=1787; Antisense; CATAGCCAGAAACCGGATTGCAATA
>probe:Drosophila_2:1637470_at:164:445; Interrogation_Position=1813; Antisense; GATGATGAACAGACTGGACCCCATT
>probe:Drosophila_2:1637470_at:645:585; Interrogation_Position=1827; Antisense; TGGACCCCATTAACTGGAAGCCGTT
>probe:Drosophila_2:1637470_at:433:115; Interrogation_Position=1845; Antisense; AGCCGTTCCAACGAAATACTCCGAG
>probe:Drosophila_2:1637470_at:280:241; Interrogation_Position=1859; Antisense; AATACTCCGAGCAATACCAAATAAT
>probe:Drosophila_2:1637470_at:465:27; Interrogation_Position=1872; Antisense; ATACCAAATAATAAGCCACGCCACG
>probe:Drosophila_2:1637470_at:407:133; Interrogation_Position=1889; Antisense; ACGCCACGCCACATATAAAGTCAAA
>probe:Drosophila_2:1637470_at:142:557; Interrogation_Position=1927; Antisense; GGACTATACACAACCACAAAGCAAT
>probe:Drosophila_2:1637470_at:66:685; Interrogation_Position=2042; Antisense; TATCTAATTAGGGTGCTACGCAGCA
>probe:Drosophila_2:1637470_at:199:673; Interrogation_Position=2058; Antisense; TACGCAGCACTACCGGGTCATTTTT
>probe:Drosophila_2:1637470_at:91:249; Interrogation_Position=2065; Antisense; CACTACCGGGTCATTTTTAAAGCAG
>probe:Drosophila_2:1637470_at:679:407; Interrogation_Position=2158; Antisense; GACGGTGATGGAAACAAGCCGCATC
>probe:Drosophila_2:1637470_at:39:175; Interrogation_Position=2216; Antisense; AAACGAAAGAATGCCTGACTATTAA

Paste this into a BLAST search page for me
TAAAGCCGAACTCCCCATAGCCAGACATAGCCAGAAACCGGATTGCAATAGATGATGAACAGACTGGACCCCATTTGGACCCCATTAACTGGAAGCCGTTAGCCGTTCCAACGAAATACTCCGAGAATACTCCGAGCAATACCAAATAATATACCAAATAATAAGCCACGCCACGACGCCACGCCACATATAAAGTCAAAGGACTATACACAACCACAAAGCAATTATCTAATTAGGGTGCTACGCAGCATACGCAGCACTACCGGGTCATTTTTCACTACCGGGTCATTTTTAAAGCAGGACGGTGATGGAAACAAGCCGCATCAAACGAAAGAATGCCTGACTATTAA

Full Affymetrix probeset data:

Annotations for 1637470_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720